Unlock instant, AI-driven research and patent intelligence for your innovation.

Down-regulation of long non-coding RNA markers in lung cancer and its application

A long-chain non-coding, marker technology, applied in the field of lung cancer down-regulating long-chain non-coding RNA markers, can solve problems such as lung damage, existing risks, sensitivity and specificity need to be improved, and achieve high accuracy and sensitivity. high effect

Active Publication Date: 2021-10-01
FIRST AFFILIATED HOSPITAL OF KUNMING MEDICAL UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The sensitivity of ultrasound diagnosis is low, and lung puncture will damage the lungs of patients, which is risky and difficult to promote. As a result, many patients are not diagnosed until the decompensated stage of lung cancer
Recent studies have found that serum metabolic markers can be used for the diagnosis of lung cancer, but their sensitivity and specificity need to be improved, and they have not been clinically used as indicators for the diagnosis of lung cancer.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Down-regulation of long non-coding RNA markers in lung cancer and its application
  • Down-regulation of long non-coding RNA markers in lung cancer and its application
  • Down-regulation of long non-coding RNA markers in lung cancer and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Diagnostic markers for lung cancer:

[0041] The present invention provides 21 types of lung cancer markers, which can be used alone or in combination of two or more to diagnose lung cancer; including: AC010776.2, AC027277.2, AC091588.3, ​​AC093110.1, AC135178 .1, AL024497.2, AL109741.1, AL136369.1, AL355499.1, AL359378.1, AL589935.1, AP001528.2, CLIC5, FENDRR, FO393415.1, LINC00472, LINC00968, LINC01290, PCAT19, TBX2- , TMEM51-AS1; its nucleotide probe sequence is shown in Table 1.

[0042] Table 1. Nucleotide probe sequences of 21 markers

[0043] landmark Nucleotide Probe Sequence AC010776.2 ATGTGGTGAGCTCGCCTGAAGACTTCAGACACGGGTCCACGTGTGTCCCAACGCCAGGAG AC027277.2 ATATTTGACACCATGATTGTCCTGAGAAATCTAGGATGCAAAATCGCCATCACCATGCAG AC091588.3 AAACATCTCTTTCAAAATAAAGGCACGAGAATCACGTTCTGTCAGCGCAGTCGCCACTGT AC093110.1 ATTAATCCAAGATGTACAGTGGAGTTTGTCTACAGAGACACTGACATGACTTCTGAAGCC AC135178.1 TGACTTTGTGGAAGCGCAGCCTTTGGGTGAGCCGG...

Embodiment 2

[0044] Example 2: Screening and identification of diagnostic markers for lung cancer

[0045] In the present invention, gene chips or real-time fluorescent quantitative PCR methods are used to screen and identify markers, but the identification is not necessarily limited to the above methods, and other methods such as chemical analysis methods are also suitable for screening and identification of markers. In the present invention, lung tissue is taken as an example to illustrate the screening and identification of markers:

[0046] 1. Obtain subject samples and perform pretreatment:

[0047] Lung tumor tissues and normal lung tissues of 23 patients with lung cancer were surgically extracted, and total RNA in tissue blocks or cells was extracted using Trizol (Invitrogen, USA). and further adopt The RNA clean-up kit (Macherey Nagel, Germany) was used to purify the total RNA through a column. Quantification was then performed by spectrophotometric methods and integrity was c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a lung cancer down-regulation long-chain non-coding RNA marker and application thereof. Such markers can be used alone or in combination of two or more for early diagnosis of lung cancer. There are 21 lung cancer markers provided by the present invention, which have the characteristics of high accuracy and high sensitivity. Among them, 4 markers, namely AC010776.2, FENDRR, LINC00968 and TMEM51-AS1, have a prediction area under the curve (AUC) exceeding 0.98, suggesting that its accuracy and sensitivity are above 98%, and can be directly used as an indicator of lung cancer.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and in particular relates to a lung cancer down-regulated long-chain non-coding RNA marker and its application. Background technique [0002] Lung cancer is the malignant tumor with the highest incidence rate in China and the world, and it is also the leading cause of cancer death in men. The incidence of lung cancer in the female population is second only to breast cancer. Global Burden of Disease (GBD) data shows that in 2016, the number of people suffering from trachea, bronchus or lung cancer in the world exceeded 2.8 million, of which the number of patients in China was as high as 1 million. In 2016, the number of deaths from the above-mentioned cancers worldwide was 1.7 million, accounting for 3.12% of the total deaths. In 2016, the number of patients who died in China was 590,000, accounting for 6.11% of the total number of deaths. Statistics show that from 1990 to 2016, the global ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6886C12N15/113
CPCC12Q1/6886C12Q2600/158C12Q2600/178
Inventor 张艳亮李文兴段勇单斌
Owner FIRST AFFILIATED HOSPITAL OF KUNMING MEDICAL UNIV