Construction method and application of human miR-106b-5p interference fragment
A technology of mir-106b-5p and hsa-mir-106b-5p, which is applied in the field of biotechnology and genetic engineering, can solve the problems that the role of miR-106b-5p is not clear and not fully elucidated, and achieve the inhibition of human skin melanoma The effect of cell proliferation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0054] A method for constructing a miR-106b-5p interference nucleotide sequence that effectively inhibits melanoma cell proliferation, comprising the steps of:
[0055] (1) Using the miRbase (http: / / www.mirbase.org / ) database, obtain the nucleotide sequence of mature hsa-miR-106b-5p (hsa-miR-106b-5p MIMAT0000680), the specific sequence is as follows:
[0056] UAAAGUGCUGACAGUGCAGAU
[0057] (2) Use Primer Premier 5.0 software to design primers. In addition to meeting the primer design principles, the designed primers should include the full-length hsa-miR-106b-5p interference sequence in the PCR product. The specific sequence of hsa-miR-106b-5p interference sequence is as follows:
[0058] CGUUCAUGGUGUCACGC
[0059] (3) Using a chemical synthesis method to synthesize RNA single strands.
[0060] (4) In order to verify the application of hsa-miR-106b-5p interference fragment in skin melanoma cells, we detected the expression of hsa-miR-106b-5p in melanoma tissue and its benig...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com