Method for cultivating broad-spectrum anti-bacterial-blight oryza sativa Indica by modifying OsSWEET gene promoters of oryza sativa Indica

A technology for resisting bacterial blight and a promoter, which is applied in the field of bioengineering to achieve the effect of improving the ability of resisting bacterial blight

Active Publication Date: 2019-10-11
SHANGHAI JIAO TONG UNIV
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is still no report on the simultaneous mutation of rice OsSWEET11, OsSWEET13 and OsSWEET14 susceptibility genes using this technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for cultivating broad-spectrum anti-bacterial-blight oryza sativa Indica by modifying OsSWEET gene promoters of oryza sativa Indica
  • Method for cultivating broad-spectrum anti-bacterial-blight oryza sativa Indica by modifying OsSWEET gene promoters of oryza sativa Indica
  • Method for cultivating broad-spectrum anti-bacterial-blight oryza sativa Indica by modifying OsSWEET gene promoters of oryza sativa Indica

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Site-directed mutation of rice OsSWEET11, OsSWEET13 and OsSWEET14 gene promoters based on CRISPR / Cas9 system:

[0036] (1) Selection of gRNA target sites

[0037] Log in to the NCBI website (https: / / www.ncbi.nlm.nih.gov / ) to query the sequences of OsSWEET11, OsSWEET13 and OsSWEET14 genes in indica rice. According to the principle of CRISPR / Cas9 technology target site design, the target site sequences SW11, SW13 and SW14 were selected in the promoter regions of OsSWEET11, OsSWEET13 and OsSWEET14 genes respectively ( figure 1 ).

[0038] (2) Construction of expression vector Cas9-gRNA5-SW134

[0039] According to the selected gRNA target sequence, synthesize primers SW11-gRNA-F (see SEQ ID NO.4), SW11-gRNA-R (see SEQ ID NO.5), SW13-gRNA-F (see SEQ ID NO. 6), SW13-gRNA-R (see SEQ ID NO.7), SW14-gRNA-F (see SEQ ID NO.8) and SW14-gRNA-R (see SEQ ID NO.9). These primers were annealed in pairs to synthesize double-stranded DNA gRNA-SW11, gRNA-SW13 and gRNA-SW14. The gRNA-...

Embodiment 2

[0049] Detection and application of MS134HZ rice resistance to strains containing PthXo1 and PthXo3 pathogenic factors:

[0050] Select two representative Xoo strains for inoculation of MS134HZ rice, including PXO99 A and PXO61. Among them, PXO99 A PXO16 is a Philippine strain containing the PthXo1 virulence factor that activates the OsSWEET11 gene; PXO16 is a Philippine strain that contains the PthXo3 virulence factor that activates the OsSWEET14 gene.

[0051] Using the leaf-cut inoculation method, the concentration of the inoculum solution for MS134HZ-4, MS134HZ-5 and Huazhan rice was OD 600 2 Xoo strains with a value equal to 0.8. The specific method is: after wetting the sterilized scissors with the bacterial solution, cut off the leaf tip by about 2 cm. Each rice plant was inoculated with 3-5 leaves, and the length of the lesion was investigated fourteen days later, and finally the average value of multiple leaves was taken for t-test difference analysis (P Figure 4 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a method for cultivating broad-spectrum anti-bacterial-blight oryza sativa Indica by modifying OsSWEET gene promoters of oryza sativa Indica. Nucleotide sequences TACTGTACACCACCAAAAGT, ATATAAAAGCACCACAACTC and CCTCCAACCAGGTGCTAAGC are simultaneously constructed into a CRISPR/Cas9 system, with the assistance of an agrobacterium-mediated transgene system, genes OsSWEET11, OsSWEET13 and OsSWEET14 are subjected to site-directed mutagenesis in rice Huazhan, the oryza sativa material MS134HZ in which the OsSWEET11, OsSWEET13 and OsSWEET14 gene promoters are mutated simultaneously is obtained, and the oryza sativa material has a broad spectrum and is resistant to rice bacterial blight. The EBEs of the promoters of the susceptible genes OsSWEET11, OsSWEET13 and OsSWEET14 of MS134HZ are simultaneously modified, the capacity of resisting the bacterial blight is improved, and the spectrum is broader. In practical application, through the hybridization of mutant MS134HZ plants and other oryza sativa varieties, disease-resistant strains are bred.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a method for cultivating broad-spectrum bacterial blight-resistant rice by modifying the rice OsSWEET gene promoter. Background technique [0002] Rice bacterial blight caused by Xanthomonas oryzae pv. oryzae (Xoo) is one of the most important bacterial diseases of rice. The disease occurs in various rice areas in my country, and the disease is severe in the southern rice areas, which has a greater impact on rice yields, and can cause a 20%-30% reduction in rice production, and in severe cases, it can reach 50%-60% or even no harvest. Breeding and planting resistant varieties is the most cost-effective means of controlling bacterial blight. At present, more than 40 bacterial blight resistance genes have been reported at home and abroad, but how to rationally select these resistance genes and create new resistance gene resources depends on the study of the inte...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/90A01H5/00A01H6/46
CPCC07K14/415C12N15/8281C12N15/902
Inventor 陈功友徐正银王赛刘龙宇马文秀刘琳琳邹丽芳
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap