Unlock instant, AI-driven research and patent intelligence for your innovation.

Nucleic acid construct for gene editing

A nucleic acid construct and gene editing technology, applied in the biological field, can solve the problems of low single-base editing efficiency and the limitation of the editable range of plant genomes

Active Publication Date: 2019-12-03
SHANDONG SHUNFENG BIOTECH CO LTD
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the efficiency of single base editing is still low compared to the currently widely used gene knockout technology
In addition, the base editors reported so far can only recognize a limited number of PAM sequences, which greatly limits the editable range of plant genomes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid construct for gene editing
  • Nucleic acid construct for gene editing
  • Nucleic acid construct for gene editing

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0244] Example 1 Using ABEmax-nCas9 to improve the base editing efficiency from A to G

[0245] The specific operation process is as follows:

[0246] 1.1 Vector construction

[0247] ABE-nCas9 editor build

[0248] For details, see Hua K, Tao X, Yuan F, Wang D and Zhu J (2018) Precise A.T to G.C Base Editing in the Rice Genome. MOL PLANT11:627-630.

[0249] ABEmax-nCas9 editor build

[0250] (1) Bis-bpNLS, codon-optimized ABE7.10 and bridge sequence composed of 96 bases were synthesized by Nanjing GenScript.

[0251] (2) Replace the ecTadA-linker-ecTadA(7.10)-linker-Cas9-SV40NLS in the original ABE editor with the synthetic sequence using the KpnI and HindIII restriction sites (Hua et al., 2018).

[0252] 1.2 sgRNA design

[0253] Design and synthesize sgRNA for rice ALS gene,

[0254] ALS-sg3: CGCATTCAAGGACATGATCCTGG (SEQ ID NO.: 9)

[0255] ALS-sg1: GCGCCCCCACTTGGGATCATAGG (SEQ ID NO.: 10)

[0256] 1.3 Rice genetic transformation process

[0257] A nucleic acid const...

Embodiment 2

[0268] Example 2 Using ABEmax-nCas9NG to expand the range of base editing

[0269] 1. Carrier construction

[0270] Using Mut The MultiS multiple site-directed mutagenesis kit (Nanjing Nuoweizan) obtained nSpCas9-NG based on nSpCas9(D10A), which contains a total of 7 amino acid substitutions R1335A / L1111R / D1135V / G1218R / E1219F / A1322R / T1337R. The mutated sequence replaced the nSpCas9 (D10A) fragment in the ABEmax-nCas9 editor by BamHI and SpeI restriction sites to obtain the ABEmax-nCas9NG editor.

[0271] In order to verify the editing feasibility of the ABEmax-nCas9NG editor in the non-traditional NGG as the PAM motif, a sgRNA (EPSPS-sg2: GAGAAGGATGCGAAAGAGGAAGT (SEQ ID NO.: 17) and ALS-sg4 was designed in the rice EPSPS and ALS genes respectively. : TAACAAAGAAGAGTGAAGTCCGT (SEQ ID NO.: 18), with AGT and CGT as the PAM motif respectively. Genetic transformation and base editing efficiency detection refer to 1.2 and 1.3 in Example 1. The identification results of transgenic ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a nucleic acid construct for gene editing and particularly relates to a nucleic acid construct. The nucleic acid construct having a specific structure is adopted, and sgRNA directed high-efficiency base site-directed mutagenesis is successfully implemented in plants for the first time (for instance, T is mutated to C, or A is mutated to G.).

Description

technical field [0001] The present invention relates to the field of biotechnology, in particular to a nucleic acid construct for gene editing. Background technique [0002] The differences in many traits in plants are caused by the mutation of one or several DNA bases, and mutations of certain specific bases can enhance, weaken or inhibit the expression of a certain trait. CRISPR-Cas9 gene editing technology has been widely used in the research of gene editing in animals and plants. At present, it mainly includes cytosine base editor (CBE) and adenine base editor (ABE). Precise base changes (such as substitutions) without causing DNA double-strand breaks (DSBs). The early developed CBE and ABE systems, consisting of rat cytidine deaminase APOBEC1 derived from lamprey cytidine deaminase PmCDA1 and TadA evolved from tRNA adenine deaminase, respectively, have been applied to many plant species In, such as rice, wheat, corn, tomato, Arabidopsis and Brassica napus. In order t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N9/78C12N9/22C12N15/82C12N5/10A01H5/00A01H6/46
CPCC12N9/78C12Y305/04002C12N9/22C12N15/8213
Inventor 不公告发明人
Owner SHANDONG SHUNFENG BIOTECH CO LTD