Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular method for changing flowering rhythm of petunia hybrida

A petunia, flowering time technology, applied in the field of molecular biology, can solve the problem of less flowering time

Active Publication Date: 2019-12-20
FUJIAN AGRI & FORESTRY UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, most researches are carried out on regulating the development of floral organs and improving flower color, and there are still few studies on flowering time.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular method for changing flowering rhythm of petunia hybrida
  • Molecular method for changing flowering rhythm of petunia hybrida
  • Molecular method for changing flowering rhythm of petunia hybrida

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] 1. Carrier Construction

[0031] (1) Synthesis of the flower-specific promoter (proCbLIS): The relevant sequence was obtained by searching on NCBI, and the GeneBank ID is AF067601. The synthesis of the sequence (SEQ ID NO: 2) was completed by Yingwei Jieji (Shanghai) Trading Co., Ltd., and the nucleotide product was obtained.

[0032] (2) Construct pK7FWG2.0-proCbLIS empty vector. The flower-specific promoter proCbLIS was passed through the unidirectional restriction endonuclease site S by restriction endonuclease ligation ac I and S pe I replaced the CaMV35S promoter of the expression vector pK7FWG2.0 to obtain the remodeled pK7FWG2.0-proCbLIS expression vector.

[0033] (3) Jasmine circadian clock gene QUR Sequence amplification of jasmine: total RNA was extracted from jasmine, reverse transcribed into cDNA. Design specific primers (5'race GSP1:CCAAAATCCCGAGAAAGGTTGCTGCT; 5'race GSP2:CTGTCCTCTTCTTGGTACTGCTTAGTGTCT; 3'race GSP1:TGGCTTACTCCCATTATGTGCTCCGT; 3'race...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention aims to provide a molecular method for regulating and controlling the flowering rhythm of petunia hybrida. In the implementation method of the molecular method, the molecular method forregulating and controlling the flowering rhythm of plants by using flower specific expression promoters and circadian clock genes together is realized in combination with the means of genetic transformation. The molecular method comprises the steps of promoter synthesis, LHY gene amplification and carrier construction, genetic transformation is carried out by using the important flower petunia hybrida with simple tissue and cell operation technology, short life cycle and clear genetic background as a transgenic model plant, and finally a transgenic plant of which the flowering time changes isobtained. The expression of the circadian clock gene LHY capable of regulating and controlling the flowering rhythm in petunia hybrida is promoted by the flower specific expression promoters, and theflowering time of the obtained transgenic plant is a new product with obvious difference compared with that of a contrast plant. Through the statistics of the flowering time of the obtained positive transgenic plant, the lowering time of the transgenic plant compared with that of a check plant is delayed by nearly four hours.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a molecular technology for regulating the flowering time of petunia. Background technique [0002] Flowering is an indispensable physiological process for plant reproduction. The control of the plant's own genes and the influence of environmental conditions jointly maintain the plant-the time for transition from vegetative growth to reproductive growth. Higher plants regulate flowering time by sensing seasonal fluctuations in daylight duration. The change in flowering time in response to sunshine duration is jointly regulated by complex environmental signals and time maintenance mechanisms related to the circadian clock. The biological clock is an endogenous mechanism that can generate an external rhythm with a cycle of nearly 24 hours, so that the internal rhythm of the plant itself and the external environmental conditions can achieve time and space coord...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/82C12N15/113C12N15/29A01H5/02A01H6/82
CPCC07K14/415C12N15/827
Inventor 张梦吕美玲伍炳华刘卓毅
Owner FUJIAN AGRI & FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com