Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of raa primer probe and detection method for detecting nodular dermatosis virus

A skin disease and nodular technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of long detection time, inconvenient operation, high false positive, etc., and achieve short detection time , easy operation, easy flux effect

Active Publication Date: 2022-06-21
CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, all of the above methods are not suitable for field conditions or in quarantine stations, and require highly skilled employees and well-equipped laboratories; based on the shortcomings of existing detection technologies such as long time, inconvenient operation, and high false positives, providing a A kind of accurate, sensitive, easy and simple to operate, the RAA fluorescence method that is applicable to spot rapid detection LSD, is the problem that those skilled in the art need to solve urgently

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of raa primer probe and detection method for detecting nodular dermatosis virus
  • A kind of raa primer probe and detection method for detecting nodular dermatosis virus
  • A kind of raa primer probe and detection method for detecting nodular dermatosis virus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Select the conserved sequence of nodular dermatosis virus LSDV002 gene for primer and probe design, find the corresponding full gene sequence in Genebank (www.ncbi.nlm.nih.gov), and use DNASTAR software for homology analysis and Blast sequence analysis , the highly conserved sequence of nodular dermatosis virus LSDV002 gene was screened out as follows:

[0048] ATATTGTCTTGGATTTTTTCATCCTTATCCAAGACAGAATCGAACGGATTTAGGTTTCCAAACATGAAGGAGATAAGCTTTTGCATTGGAAACATTAATAATGAATACAAACTATATATAATTAAATTACATAATCTAGCTATATAAAAAATACACAACAT(SEQ ID NO. 1);

[0049] Taking the highly conserved sequence obtained by screening as the target gene fragment for detection, a positive plasmid is synthesized, and primers and probes are designed for screening and detection.

[0050] The conserved sequence of the above nodular dermatosis virus LSDV002 gene was entrusted to Sangon Bioengineering (Shanghai) Co., Ltd. to synthesize a DNA plasmid with a size of 3106bp.

[0051] (1) Primer design

[0052] ...

Embodiment 2

[0078] A method for detecting LSDV virus by RAA fluorescence method, comprising the following steps:

[0079] (1) Homogenize the tissue of the sample to be tested, extract nucleic acid according to the method of DNA extraction from tissue, and store it at -20°C for later use; if the sample is whole blood, serum, or plasma, use the steps of lysis, magnetic bead enrichment, washing, and elution to extract nucleic acid ;

[0080] (2) Connect the constant temperature fluorescent gene detector RAA-F1620 to the power supply for preheating, and set the reaction parameters. The reaction parameters are set to 39°C, and the reaction time: 20min;

[0081] (3) Add 13.7 μL of water, 2.1 μL of upstream and downstream primers and 0.6 μL of probes with a concentration of 10 μM to 25 μL of reaction buffer, mix them thoroughly, and add them to the RAA fluorescent basic reaction reagent and mix to obtain a reaction premix;

[0082] (4) Add 2.5 μL of Mg to the cap of the reaction tube 2+ , full...

Embodiment 3

[0147] Embodiment 3 Actual sample detection

[0148] (1) The sequences of primers, probes and negative quality control substances are the same as those of Example 1.

[0149] (2) A total of 15 clinical samples from 1 to 15 in the experiment were provided by the National Research Center for Exotic Animal Diseases;

[0150] (3) Sample extraction method:

[0151] Tissue samples were first homogenized, and then nucleic acid was extracted according to the method of DNA extraction from commercial tissue of Tiangen; serum and plasma were extracted by lysis, magnetic bead enrichment, washing, elution and other steps; stored at -20°C for future use;

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a primer, a probe and a detection method for detecting nodular skin disease virus by RAA fluorescence method, wherein the primer and probe are suitable for RAA fluorescence method detection, and can accurately detect nodular skin disease virus plasmid , has no cross-reaction with mycoplasma, bovine infectious rhinotracheitis virus, bovine viral diarrhea virus, bovine parainfluenza virus, bovine respiratory syncytial virus, goat pox virus, and sheep pox virus, with a specificity of 100%; the detection method is rapid, It is easy to realize high-throughput, while reducing detection time and detection cost. The method for rapid detection of nodular skin disease virus DNA based on RAA fluorescence method provided by the present invention has high sensitivity, and the detection sensitivity of each reaction reaches 10copies / reaction.

Description

technical field [0001] The invention belongs to the technical field of virus detection, in particular to a RAA primer probe and a detection method for detecting nodular dermatosis virus. Background technique [0002] Nodular dermatosis (Knopvelsiekte, LSD) is a pox disease of cows, which, as well as sheep pox, is a systemic infection caused by members of the goatpox virus genus; it is characterized by fever, skin, mucous membranes, and internal organs Nodules, weight loss, swollen lymph nodes, edema of the skin, and sometimes death occur. The disease can damage hides and reduce performance, especially in dairy cows, and has been recognized as an OIE-listed transboundary disease of economic importance. The genome of the LSD virus (LSDV) contains double-stranded DNA approximately 150,000 base pairs (bp) in length. The geographical distribution of LSDV is different from sheeppox and goatpox. The strains of LSD are usually only found in cattle; the transmission of LSDV is main...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/6844C12N15/11
CPCC12Q1/701C12Q1/6844C12Q2531/119C12Q2563/107
Inventor 吴晓东樊晓旭李林南文龙赵洋蔡禹希郭利川应清界吴发兴
Owner CHINA ANIMAL HEALTH & EPIDEMIOLOGY CENT
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com