A kind of raa primer probe and detection method for detecting nodular dermatosis virus
A skin disease and nodular technology, applied in biochemical equipment and methods, DNA/RNA fragments, recombinant DNA technology, etc., can solve the problems of long detection time, inconvenient operation, high false positive, etc., and achieve short detection time , easy operation, easy flux effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Select the conserved sequence of nodular dermatosis virus LSDV002 gene for primer and probe design, find the corresponding full gene sequence in Genebank (www.ncbi.nlm.nih.gov), and use DNASTAR software for homology analysis and Blast sequence analysis , the highly conserved sequence of nodular dermatosis virus LSDV002 gene was screened out as follows:
[0048] ATATTGTCTTGGATTTTTTCATCCTTATCCAAGACAGAATCGAACGGATTTAGGTTTCCAAACATGAAGGAGATAAGCTTTTGCATTGGAAACATTAATAATGAATACAAACTATATATAATTAAATTACATAATCTAGCTATATAAAAAATACACAACAT(SEQ ID NO. 1);
[0049] Taking the highly conserved sequence obtained by screening as the target gene fragment for detection, a positive plasmid is synthesized, and primers and probes are designed for screening and detection.
[0050] The conserved sequence of the above nodular dermatosis virus LSDV002 gene was entrusted to Sangon Bioengineering (Shanghai) Co., Ltd. to synthesize a DNA plasmid with a size of 3106bp.
[0051] (1) Primer design
[0052] ...
Embodiment 2
[0078] A method for detecting LSDV virus by RAA fluorescence method, comprising the following steps:
[0079] (1) Homogenize the tissue of the sample to be tested, extract nucleic acid according to the method of DNA extraction from tissue, and store it at -20°C for later use; if the sample is whole blood, serum, or plasma, use the steps of lysis, magnetic bead enrichment, washing, and elution to extract nucleic acid ;
[0080] (2) Connect the constant temperature fluorescent gene detector RAA-F1620 to the power supply for preheating, and set the reaction parameters. The reaction parameters are set to 39°C, and the reaction time: 20min;
[0081] (3) Add 13.7 μL of water, 2.1 μL of upstream and downstream primers and 0.6 μL of probes with a concentration of 10 μM to 25 μL of reaction buffer, mix them thoroughly, and add them to the RAA fluorescent basic reaction reagent and mix to obtain a reaction premix;
[0082] (4) Add 2.5 μL of Mg to the cap of the reaction tube 2+ , full...
Embodiment 3
[0147] Embodiment 3 Actual sample detection
[0148] (1) The sequences of primers, probes and negative quality control substances are the same as those of Example 1.
[0149] (2) A total of 15 clinical samples from 1 to 15 in the experiment were provided by the National Research Center for Exotic Animal Diseases;
[0150] (3) Sample extraction method:
[0151] Tissue samples were first homogenized, and then nucleic acid was extracted according to the method of DNA extraction from commercial tissue of Tiangen; serum and plasma were extracted by lysis, magnetic bead enrichment, washing, elution and other steps; stored at -20°C for future use;
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


