Controllable up-regulation of ang-(1-7) expression vector for targeted prevention and treatment of hypoxic pulmonary hypertension

A technology for expressing vectors and promoters, applied in the direction of polypeptides, vectors, and nucleic acid vectors containing positioning/targeting motifs, which can solve the problems of lack of specificity in administration routes, lower blood pressure in the systemic circulation, and aggravate hypoxemia, etc. Achieve good application prospects, inhibit structural reconstruction, and improve tissue specificity

Active Publication Date: 2021-08-31
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the conventional route of administration lacks specificity, leading to the side effect of lowering systemic blood pressure
Moreover, long-term, single expansion of pulmonary vessels can also lead to venous blood doping and aggravate hypoxemia

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Controllable up-regulation of ang-(1-7) expression vector for targeted prevention and treatment of hypoxic pulmonary hypertension
  • Controllable up-regulation of ang-(1-7) expression vector for targeted prevention and treatment of hypoxic pulmonary hypertension
  • Controllable up-regulation of ang-(1-7) expression vector for targeted prevention and treatment of hypoxic pulmonary hypertension

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0038] The present invention will be described in further detail below in conjunction with the accompanying drawings and embodiments.

[0039] 1. Construction, identification and sequencing verification of recombinant plasmid HRE-Tie2-FC-Ang-(1-7)

[0040] Whole gene synthesis 6×HRE sequence (rat HRE: 5'GACTCCACAGTGCATACGTGGGCTTCCACAGGTCGTCTC3') and Tie gene (Tyrosine kinase with Id EGF homology domains) promoter (Mus musculus receptor tyrosine kinase Tie2 gene, 5'-flanking region, accessnumber r AF022456.1, location: AF022456.1:1–223, referred to as Tie2 promoter). At the same time, synthetic signal peptide and hIgG1Fc fusion marker (SPFc: 5'ATGAAACATCTGTGGTTCTTCCTTCTCCTGGTGGCAGCTCCCAGATGGGTCCTGTCC3', signal peptide and fusion marker are fused in a sequence, the sequence has two corresponding functions) and rat Ang-(1-7) coding sequence (5'GACCGGGTGTACATACACCCC3'), and clone the above sequence into pUC57 (Shenzhen Baienwei Biotechnology Co., Ltd.) to obtain the template plas...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an expression vector for controllably up-regulating Ang-(1-7) targeted prevention and treatment of hypoxic pulmonary hypertension. The present invention constructs an HRE-enhanced, Tie2 promoter-driven Ang-(1-7) expression vector, which is specifically located in vascular endothelial cells through the Tie2 promoter, and at the same time, uses HIF-1α to express specificity only in hypoxic pulmonary vascular endothelial cells. Sexually activates HRE, thereby upregulating Ang‑(1‑7) expression. The present invention finds that the constructed expression vector is not only targeted, but also can controllably and effectively up-regulate the expression of Ang-(1-7) in hypoxic pulmonary microvascular endothelial cells according to the degree of hypoxia, and then regulate pulmonary artery smooth muscle cells , to achieve controllable hypoxia, targeted inhibition of pulmonary artery contraction and reversal of pulmonary artery structural reconstruction, and provide effective means and strategies for the prevention and treatment of hypoxic pulmonary hypertension and other diseases.

Description

technical field [0001] The present invention relates to the field of applying gene recombination technology to treat hypoxic pulmonary hypertension, in particular to angiotensin-(1-7) [Angiotensin-(1-7), Ang-(1-7) driven by HRE-enhanced Tie2 promoter ] Construction method of expression vector. Background technique [0002] Hypoxic pulmonary hypertension (HPH) is a common link in many respiratory diseases, chronic altitude sickness and various diseases related to hypoxemia. Hypoxic pulmonary vasoconstriction caused by hypoxia is one of the important physiological responses of the body, and it is of great significance in maintaining the ventilation / blood flow ratio around the hypoxic alveoli, reducing functional shunts, and increasing blood oxygen saturation. However, long-term and extensive hypoxic pulmonary vasoconstriction can lead to remodeling of pulmonary vascular structure. The reconstruction of pulmonary vascular structure is a key factor that causes continuous incre...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/864C12N15/85C12N15/62A61K48/00A61K38/08A61P7/02A61P9/10A61P9/12A61P9/14
CPCA61K38/085A61K48/0058A61K48/0066A61P7/02A61P9/10A61P9/12A61P9/14C07K7/14C07K2319/02C07K2319/30C12N15/85C12N15/86C12N2750/14143C12N2800/107C12N2830/002C12N2830/008
Inventor 刘曼玲董明清李志超董海莹赵澎涛张博
Owner FOURTH MILITARY MEDICAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap