Cad96ca gene related to German cockroach epidermal development, dsRNA of gene as well as preparation method and application of dsRNA
A German cockroach and epidermis technology, applied in the field of genetic engineering, can solve problems such as human health and safety hazards and difficult management
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1 of the present invention is: the design and synthesis of dsRNA:
[0033] Total RNA from the fat body of Blattella germanica was extracted using TRIzol (Life Technologies), and then the first strand of cDNA was synthesized by reverse transcription (PrimeScript II reverse transcriptase (Takara Bio, Shiga, Japan)) using OligodT primers.
[0034] According to the existing genome information of the German cockroach, the complete sequence of the Cad96ca gene of the German cockroach was found by comparing with other species, as shown in SEQ ID No.1.
[0035] SEQ ID No. 1:
[0036]ATGATTCGGAACTGGGTCATCCAGGACACGGTTCCCTTGGGAGAAATCGTCGCCAGGGTGAGAGCCGAGGACTCCGAGATGGACAGACTCGTGTACGGGTTGGAACCCAAGTTCAGTGGCGGAGGCGCCTACAACAAGCCCTTGCCCTTCGTCATCAACAACACGACGGGCATCGTCAAGGTCAACGACTCTCTCCTCAACAGGGGCGGCGAGCAGTTCCTCCTGTACGTCACAGTGAGCGACGGAAAACTGACGAGCAAAAACGAAGTTTGGGTGAAGATCGTCAACTCGTCAGCGGACCCCGATTCGTCCAACATCAACAGTGGCGGGCCACCGCTGGGGGCGGCGAGTTTCCTGCCGAAATTCCACTCCCAATACCCTGGGGGCGGCA...
Embodiment 2
[0043] Embodiment two of the present invention is: the application of dsRNA (in vivo experiment of German cockroach):
[0044] In order to verify the influence of the dsRNA targeting the Cad96ca gene prepared by the present invention on the development of the epidermis of the German cockroach, it is implemented by injecting the dsRNA into the German cockroach. CK, which does not target any gene of Blattella germanica, was used as a negative control for dsRNA.
[0045] The steps are as follows: select 5-year-old (N5) and 6-year-old (N6) German cockroaches that have just molted and raise them, place them on the microscope dissecting table after anesthesia at low temperature on the second day after their molting, and then use microinjection Methods The dsRNA targeting the silencing of the Cad96ca gene was injected into the abdomen of the German cockroach at a certain dose, and the injection was performed once in total. After the injection, the effect of dsRNA treatment on the mol...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap