Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Qtl-linked Molecular Markers for Wheat Effective Tiller Number and Its Application

A molecular marker and tiller number technology, which is applied in the fields of molecular biology and crop genetics and breeding, can solve the problem of insufficient molecular markers, and achieve the effects of accurate and efficient detection, convenient and stable amplification, and high success rate

Active Publication Date: 2021-06-15
SICHUAN AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are not many closely linked molecular markers that are related to the trait of effective tiller number in wheat and can be used in practical molecular breeding.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Qtl-linked Molecular Markers for Wheat Effective Tiller Number and Its Application
  • Qtl-linked Molecular Markers for Wheat Effective Tiller Number and Its Application
  • Qtl-linked Molecular Markers for Wheat Effective Tiller Number and Its Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Acquisition of wheat effective tiller number QTL Qetn-1B.1 and its molecular marker KASP-1

[0041] (1) Using the wheat line '20828' as the female parent and the wheat variety 'SY95-71' as the male parent to cross, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 7 Generations, recombinant inbred lines containing 128 lines were obtained to form a genetic mapping population.

[0042] (2) Phenotypic identification of the effective tiller number of recombinant inbred lines: analyze and identify the effective tiller numbers of recombinant inbred lines at the maturity stage of wheat, remove the individual plants at both ends of each row, collect five individual plants with the same growth, and calculate the effective Tiller number, and get the average value, which represents the effective tiller number of the strain.

[0043] (3) 55K SNP chip analysis

[0044] a) DNA extraction: DNA of parent '20828', 'CN16' and rec...

Embodiment 2

[0052] Example 2 Application of Molecular Marker KASP-1 in Selection and Control of Effective Tiller Number QTL Qetn-1B.1

[0053] (1) Using the common wheat line 'S849-8' with few effective tillers as the female parent and the common wheat line 'SY95-71' with the large effective tillers as the male parent to construct a recombinant inbred line, and randomly select among the offspring lines 83 strains.

[0054] (2) Carry out KASP-1 marker detection on the obtained 83 strains, the specific method is: extract the DNA of 83 strains; use it as a template, and carry out PCR with the specific primer pair of molecular marker KASP-1 as primers To amplify and perform a fluorescent readout, the primers are:

[0055] Primers on the FAM tag: (the underlined part is the FAM tag sequence)

[0056] 5'- GAAGGTGACCAAGTTCATGCT TAATTCAGCAACTATTCCCCA-3' (SEQ ID No. 1)

[0057] Primers on the HEX tag: (the wavy part is the HEX tag sequence)

[0058] 5'- GAAGGTCGGAGTCAACGGATT TAATTCAGCAACTA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker linked to QTL for effective tiller number in wheat and its application. The wheat effective tiller number QTL is QTL Qetn-1B.1, the molecular marker is named KASP-1, and its nucleotide sequence is shown in SEQ ID NO.1-3. Detection and analysis showed that the molecular marker could accurately track the wheat effective tiller number QTL Qetn‑1B.1, predict the effective tiller number characteristics of wheat, and facilitate molecular design breeding. The invention also discloses a method for identifying the molecular markers of wheat effective tiller number QTL Qetn-1B.1. The method provided by the invention can enhance the accuracy of prediction of effective tiller number, so as to quickly screen out the QTLs with increased effective tiller number. A large number of wheat varieties or lines are used for breeding, which can greatly speed up the process of breeding high-yield varieties of wheat.

Description

technical field [0001] The invention relates to the fields of molecular biology and crop genetic breeding, in particular to a SNP molecular marker linked to wheat effective tiller number QTLQetn-1B.1 and the application of the molecular marker. Background technique [0002] Common wheat (Triticum aestivum L.) is the main food crop in the world, with an annual planting area of ​​about 4.5 million hectares. Rapid growth in annual wheat production is urgently needed due to the continued decrease in the global arable land area and the increase in population. [0003] The three factors that constitute the yield of wheat are the number of spikes, the number of grains per spike and the weight of thousand grains. The number of spikes per hectare is calculated based on the number of effective tillers, so the number of effective tillers is an important factor affecting wheat yield. Tillering is a unique branching phenomenon of monocotyledonous plants, so it has important research si...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 马建兰秀锦刘家君郑有良魏育明江千涛刘亚西陈国跃李伟
Owner SICHUAN AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com