Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

HER2 gene humanized mouse tumor cell model as well as construction method and application thereof

A construction method and tumor cell technology, applied in the application of biomedicine, in the field of construction of muHER2 gene humanized animal tumor cell models, can solve problems such as toxic reactions and restrictions on the development and application of anti-human HER2 antibodies

Pending Publication Date: 2020-05-01
NANJING BIOHENG BIOTECH CO LTD
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But at the same time, severe clinical toxic side effects led to the emergency suspension of clinical trials. More than half of the patients treated with Ipilimumab had severe side effects of grade 3-4, leading to skin, pituitary and intestinal toxic reactions, which limited the ability of anti-human HER2 Antibody development and application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HER2 gene humanized mouse tumor cell model as well as construction method and application thereof
  • HER2 gene humanized mouse tumor cell model as well as construction method and application thereof
  • HER2 gene humanized mouse tumor cell model as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0052] 1.1 mu HER2 sgRNA design

[0053] 1.1.1 sgRNA oligonucleotide chain synthesis

[0054] Use the CRISPR online design tool (http: / / crispr.mit.edu / ) to design two 20bp sgRNAs on exon 3 of HER2 according to the scoring system. The core sequences on the exons were found according to these two criteria: HER2 sgRNA-1 and HER2 sgRNA-2. CACCG was added to the 5′ end of the coding strand template, and AAAC…………….C was added to the 3′ end of the non-coding strand template to complement the cohesive ends formed after digestion with BsmbI, and two pairs of CRISPR oligonucleotide chains were designed.

[0055] 1.1.2 Exon 3 sequence of muHer2:

[0056] As shown below, where the underline is the target position:

[0057] GACATCCAGGAAGTCCAGGGATACATGCTCATCGCTCACAACCGAGTGAAACACGTC CCA CTGCAGAGGTTG CGCATCGT GAGAGGGACTCAGCTCTTTGAGGACAAGTATGCCCTGGCTGT GCTAGACAACCGAGACCCTT TGG ACAACGTCACCACCGCCGCCCCAGGCAGAACCCCAGAAGGGCTGCGGGAGCTGCAGCTTCGAAGTCTCACAG (SEQ ID NO. 1)

[0058] 1.1.3 m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of animal cell genetic engineering and gene genetic modification, and particularly relates to a construction method and application of an HER2 gene humanized mousetumor cell model. The method uses a CRISPR technology to knock out a mouse HER2 gene, and uses slow viral infection to insert a humanized HER2 gene into mouse breast cancer cell 4T1. The HER2 humanized mouse breast cancer humanized tumor model constructed by the method can be used not only for evaluation of antibody tumor drug efficacy, but also has important guiding significance for a clinical effect of drug development; and at the same time, the model is also an ideal model for safety evaluation of anti-human HER2 antibody drugs, pre-clinical in-vivo evaluation is performed on toxicology ofHER2 antibody drugs and HER 2-CAR T, HER 2-CAR NK immune cell therapy, and the market gap is filled.

Description

technical field [0001] The invention belongs to the technical field of animal genetic engineering and genetic modification, and relates to a method for constructing a muHER2 gene humanized animal tumor cell model based on CRISPR / Cas9 technology and its application in biomedicine. Background technique [0002] HER2 is also known as CerbB-2, Chinese name is human epidermal growth factor receptor-2. About 15-20% of breast cancer patients are Her-2 positive, an abnormal amplification of the Her-2 gene, which is one of the causes of this type of breast cancer. Studies have shown that Her-2 is positive, indicating that the patient's cancer cells have a higher degree of malignancy and a shorter survival period than other types. [0003] Breast cancer is currently the first malignant tumor in Chinese women, which seriously threatens the health of patients. HER2-positive breast cancer accounts for about 20% to 30% of invasive breast cancers, and is associated with high tumor inva...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/867C12N15/90C12N9/22C12N15/113C12N5/10C12Q1/02
CPCC12N15/86C12N15/907C12N9/22C07K14/82C12N5/0693C12N15/113G01N33/5011C12N2740/15043C12N2310/20G01N2500/10
Inventor 赵恩峰贺小宏王延宾任江涛韩露
Owner NANJING BIOHENG BIOTECH CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More