Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

African swine fever virus vaccine, its preparation method and application

An African swine fever virus and virus vector technology, applied in the field of vaccines, African swine fever virus vaccines, and its preparation, can solve the problems of cross-reaction, poorly understood genes and mechanisms, side reactions of live attenuated vaccines, etc. The effect of duplicating, alleviating inhibition, and broad application prospects

Active Publication Date: 2020-08-04
苏州沃美生物有限公司
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For example, CN110093324A and CN106459931A have proposed attenuated strains of African swine fever virus with different genes knocked out as live attenuated vaccines for African swine fever. side effects, and because the research on African swine fever virus is not thorough enough, the virus virulence-related genes and mechanisms are not well understood, and these attenuated live vaccines have not yet undergone rigorous and comprehensive safety assessments, so the biological risk of vaccines great
CN109836478A, CN104311660A provide a kind of preparation method of African swine fever virus polyclonal antibody, but polyclonal antibody is easy to produce a large number of non-specific antibodies, and the multi-epitope recognition of polyclonal antibody may produce cross reaction simultaneously
The patent of CN109734810A has applied for a method for preparing anti-African swine fever virus and CD dual-target swine-derived antibody, but there may be problems that the dual target of the antibody is difficult to balance, and the antibody binds to immune cells to activate the immune system and cause a cytokine storm; Antibodies on target may reduce immunogenicity and stability of antibody structure

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • African swine fever virus vaccine, its preparation method and application
  • African swine fever virus vaccine, its preparation method and application
  • African swine fever virus vaccine, its preparation method and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0058] A method for preparing a combination of recombinant adeno-associated virus vectors provided by an aspect of the embodiments of the present invention includes:

[0059] providing the first AAV vector comprising one or more coding genes of recombinant porcine α, β, γ interferon;

[0060] providing a second AAV vector comprising a gene encoding a recombinant African swine fever virus neutralizing antibody;

[0061] providing a third AAV vector comprising one or more coding genes of recombinant African swine fever virus antigenic proteins P72, P30, PP62, and PP220;

[0062] providing a fourth AAV vector comprising a DNA sequence capable of transcribing shRNA for at least one of the African swine fever virus A104R, I215L genes;

[0063] Transfect host cells with the first AAV vector, the second AAV vector, the third AAV vector, and the fourth AAV vector respectively, and obtain a combination of recombinant adeno-associated virus vectors (that is, recombinant AAV viruses) af...

Embodiment 1

[0138] Example 1 Preparation of recombinant AAV expressing chimeric ASFV P54 neutralizing antibody

[0139] The amino acid sequence of the P54 protein of an ASFV isolated from China (Gene Bank accession number: MK128995) was codon-optimized (SEQ ID No: 1), synthesized and cloned into the pCI expression vector at Nanjing GenScript, and the Add a His tag to the C-terminus, insert it between the restriction enzymes MluI and XhoI of the pCI vector to obtain the pCI-P54His plasmid, use Escherichia coli to amplify the pCI-P54His plasmid, and extract the plasmid to transfect 293 cells to obtain P54His protein (SEQ ID No: 2). After SDS-PAGE detection was performed to confirm the correct expression, the prepared P54 His protein was used to immunize mice to prepare African swine fever virus P54 monoclonal antibody and hybridoma cell lines.

[0140] After the hybridoma cell line is screened, the antibody variable region gene sequence is amplified, and the light chain variable region (the ...

Embodiment 2

[0143] Example 2 Preparation of recombinant adeno-associated virus for African swine fever A104R and I215L gene shRNA

[0144] The DNA sequences capable of transcribing shRNA were designed for the A104R gene and I215L gene of African swine fever virus respectively. The DNA sequences are as follows:

[0145] A104R sense strand (SEQ ID NO.24):

[0146] cgcaagagctttactccttagtagcggcagttcaagagactgccgctactaaggagtaaagctcttgctttttta

[0147] A104R antisense strand (SEQ ID NO.25):

[0148] agcttaaaaaagcaagagctttactccttagtagcggcagtctcttgaactgccgctactaaggagtaaagctcttgcggtac

[0149] The above-mentioned sense strand and antisense strand templates include cohesive ends and shRNA sequences. The sequence of the shRNA is: 5'-gcaagagcuuuacuccuuaguagcggcaguucaagagacugccgcuacuaaggaguaaagcucuugcuuuuuu-3' (SEQ ID NO.10), wherein uucaagaga is a loop structure, and the restriction site is Kpn1 ( ggtacc).

[0150] I215L sense strand (SEQ ID NO.26):

[0151] cgacacctgatagagaatccctctgagaatttcaagag...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an African swine fever virus vaccine, its preparation method and application. The preparation method of the African swine fever virus vaccine comprises: providing an AAV vector comprising a recombinant porcine interferon coding gene; providing an AAV vector comprising a recombinant African swine fever virus neutralizing antibody coding gene; providing a plurality of antigens comprising a recombinant African swine fever virus The AAV vector of the protein coding gene; provide the AAV vector containing the gene that can transcribe shRNA for the key gene of African swine fever virus; transfect the host cells with the aforementioned AAV vector, and obtain multiple recombinant AAV after culture and post-treatment Virus. The African swine fever virus vaccine provided by the present invention can provide multiple barriers for preventing and treating ASFV virus infection, so it can realize comprehensive prevention and treatment of African swine fever virus infection, has high safety, strong immunogenicity, and no pathogenicity to animals Etc.

Description

technical field [0001] The invention relates to a vaccine, in particular to an African swine fever virus vaccine, its preparation method and application, and belongs to the technical field of animal immune medicines. Background technique [0002] African swine fever (ASF) is an acute, febrile, highly contagious disease of pigs caused by African swine fever virus (ASFV), clinically manifested as high fever, skin congestion, edema, and dirty Extensive organ bleeding and changes in the function of the respiratory system and nervous system. The onset of the disease is short, with an incubation period of 5-15 days, high morbidity and mortality, and the mortality rate can even be as high as 100%. In countries or regions infected by the pathogen, it can cause huge economic losses, seriously threaten food safety and affect the pig industry. The World Organization for Animal Health (OIE) lists it as a Class A epidemic disease, and my country stipulates that it is a Class I animal d...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/864A61K39/12A61K39/39A61K39/42A61K31/713A61P31/20G01N33/569
CPCA61K31/713A61K39/12A61K39/39A61K39/42A61K2039/53A61K2039/552A61K2039/55522A61P31/20C12N15/111C12N15/86C12N2320/32C12N2710/12034C12N2750/14143G01N33/56983G01N2333/01G01N2469/10G01N2469/20A61K2300/00
Inventor 曹文龙孔迪孙祥明滕小锘张大鹤易小萍
Owner 苏州沃美生物有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com