Fermentation production and post-treatment of glutamic acid

A technology of glutamic acid and bacteria, which is applied in the field of amino acid fermentation, can solve the problems of difficult expansion of production scale, odorous exhaust gas, and low added value, and achieve the effects of improving comprehensive economic benefits, reducing odorous exhaust gas, and increasing yield

Active Publication Date: 2020-08-14
INNER MONGOLIA EPPEN BIOTECH CO LTD
View PDF10 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Yet the present inventor finds, this method yield is lower, is 88%-90%, and a large amount of composition dissolves in mother liquor and the filtrate thereafter, dries into the compound fertilizer with low added value, and because dissolves a large amount of fermentation to produce in mother liquor Ammonia nitrogen, the drying process will produce a large amount of odorous waste gas, it is difficult to expand the production scale under the current situation of increasing emphasis on environmental protection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 NCgl0866 Gene expression downregulation experiments

[0037] According to the genome sequence of Corynebacterium glutamicum ATCC13032 published by NCBI, two pairs of amplification were synthesized NCgl0866 Primers for fragments at both ends of the gene coding region, as upstream and downstream homology arm fragments. Primers were designed as follows (synthesized by Shanghai Yingjun Company):

[0038] P7: 5' CGGAATTCGATGCCTGC GGGATGACGA 3' (BamH1)

[0039] P8: 5'GATGACGAAG GAGCCCCTAT CCAGAGCCAC CAAACCTGGG ACG3'

[0040] P9: 5'CGTCCCAGGT TTGGTGGCTC TGGATAGGGG CTCCTTCGTC ATC3'

[0041] P10: 5' CGGGATCCCCTAAACCCTGTCTCAAAATCAC 3' (EcoR1)

[0042] Using Corynebacterium glutamicum ATCC13032 as a template, PCR amplification was performed with primers P7 / P82 and P9 / P10 respectively to obtain a 680bp upstream homology arm fragment and a 800bp downstream homology arm fragment, and then OVER PCR with primers P7 / P10 to obtain The entire homology arm fragment is 148...

Embodiment 2

[0047] Example 2 Glutamic acid fermentation experiment

[0048] The genetically engineered strain and the original bacterial strain constructed in Example 1 were shaken and cultured in liquid LB medium respectively until the OD500 reached 0.5, and were inserted into the glutamic acid fermentation medium with a 5% inoculum size (the formula per liter of medium was: 80g sucrose , 20g NH 4 Cl, 45g CaCl 2 ,1g KH 2 PO 4 , 1g peptone, 400mg MgSO 4 ·7H 2 O, 10mg FeSO 4 ·7H 2 O, 10mg MnSO 4 ·7H 2 O, 300 μg of biotin, 50 μg of thiamine hydrochloride, and 4 mg of chloramphenicol, adjusted to pH 7.8 with NaOH) were incubated at 30°C with shaking (150 rpm) for 72 hours. The culture supernatant (ie, fermentation broth) was collected by centrifugation, and L-glutamic acid in the culture medium was separated and quantified by paper chromatography. It was found that the content of L-glutamic acid in the fermentation medium of the genetically engineered strain reached 36g / L, while th...

Embodiment 3

[0049] Example 3 Post-treatment method of glutamic acid fermentation broth

[0050] First, extract the glutamic acid crystal form from the glutamic acid fermentation broth (enlarged-scale production such as the fermentation broth produced in Example 2) basically referring to the existing continuous isoelectric point method, the difference is that the fermentation broth is not filtered or Ultrafiltration, but centrifugation. Specifically, the glutamic acid fermentation broth is centrifuged, and the isolated bacterial precipitate is ready for use, and the supernatant is concentrated by a four-effect vacuum evaporator (because the centrifugation also removes part of the bacterial protein, the concentration ratio can be increased to 38-40g / dl), the obtained concentrated solution passes through the acid adjustment tank continuously (the acid adjustment tank in large-scale extraction can be divided into multiple stages, such as passing through the first-level acid adjustment tank, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a method for producing L glutamic acid by fermentation. The method comprises the following steps: modifying a gene for coding DNA methylase on a chromosome of a corynebacteriumbacterium to reduce the activity and / or expression quantity of the DNA methylase; and producing the L glutamic acid by fermenting the bacterium obtained by modification. In addition, the invention also provides a method for treating glutamic acid fermentation liquor.

Description

technical field [0001] The invention belongs to the field of amino acid fermentation, in particular, the invention relates to methods and applications of fermentative production of L-glutamic acid, bacteria that can be used in these methods and applications, and post-treatment methods. [0002] related application [0003] This application is a divisional application of Chinese Patent Application No. 201711350944.1 (filing date: December 15, 2017). Background technique [0004] L-glutamic acid is an important amino acid raw material, which has been widely used as seasoning and food additive. At present, the production of L-glutamic acid is mainly through the fermentation of microorganisms, such as coryneform bacteria can be used for production. [0005] The microorganisms used for fermentation production can be wild-type microorganisms, but most of them are auxotrophs, drug-resistant mutants and metabolic mutants with higher yields obtained through mutagenesis or genetic e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12P13/14C12N15/77C12N15/90C12N15/54C12N1/21C05G3/80C05G5/12C12R1/15
CPCC12N9/1007C12P13/14C05F5/008C05G3/80C12N15/77C12N15/902C12Y201/01072C05G5/12C05F11/02
Inventor 马吉银赵二红哈志瑞马文友
Owner INNER MONGOLIA EPPEN BIOTECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap