Oligonucleotide and application thereof

An oligonucleotide and polynucleotide technology, which is applied in the application, medical preparations with non-active ingredients, and medical preparations containing active ingredients, etc., to achieve the effects of relieving corneal dystrophy lesions, preventing deterioration and preventing the occurrence of diseases

Active Publication Date: 2020-10-30
WUHAN NEUROPHTH BIOTECHNOLOGY LTD CO
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] At present, there is no RNAi drug for the treatment of diseases caused by TCF4 mutations, especially corneal dystro

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oligonucleotide and application thereof
  • Oligonucleotide and application thereof
  • Oligonucleotide and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0105] Example 1: Luciferase reporter system screening for efficient RNAi target sequences

[0106] In 293 cells, luciferase plasmids containing mutant TCF4 sequences were co-transfected with RNAi controls (random sequences not targeting TCF4: CCGCCTTTTGAAGGCAAGTC, random sequences used in any of the following controls) or candidate RNAi drugs (including 20 oligonucleotides of the present invention) 23 oligonucleotides targeting intron 2 of TCF4 including nucleotides, please refer to the plasmid map figure 1 A and figure 1 B). After 48 hours of transfection, the luciferase activity was detected, and it was found that compared with the transfection RNAi control, the 20 oligonucleotides provided by the present invention had a significant inhibitory effect on the luciferase activity of mutant TCF4 ( figure 2 middle RNAi-1-20), while the remaining 3 oligonucleotides had no significant inhibitory effect on TCF4 RNA levels. This indicates that the oligonucleotides provided by th...

Embodiment 2

[0107] Example 2: RNAi drug treatment reduces intron 2 RNA foci of mutated TCF4

[0108] AAV infects 293 cells: the recombinant virus AAV2-ctrl (carrying a random sequence that does not target TCF4 is a virus vector of AAV2), AAV2-RNAi-X (carrying an oligonucleotide serotype is a virus vector of AAV2, X represents the serial number of the aforementioned 1-23 oligonucleotides, the same below) The medicine is MOI=1*10 4 The multiplicity of infection of vg / cell infected 293 cells. After 48 hours of infection, the cells were sampled to detect the RNA foci content.

[0109] Using the CRISPR-Cas9 method, a stable cell line with CTG repeat expansion in intron 2 of 293-TCF4 was constructed. In the TCF4 mutant cells, the chemically synthesized RNAi-X drug (i.e. the aforementioned oligonucleotide, X represents the sequence number of the aforementioned 1-23 oligonucleotides, the same below) and the ctrl control (the aforementioned random sequence) were transfected. After 24 hours of t...

Embodiment 3

[0111] Example 3: RNAi drugs have no significant effect on the expression level of wild-type TCF4 gene

[0112] AAV infection of B4G12 cells: the recombinant virus AAV2-ctrl, AAV2-RNAi-X drug at MOI=1*10 4 B4G12 cells were infected with a multiplicity of infection of vg / cell. 48h after infection, RNA was extracted to detect the content of TCF4 protein.

[0113] Although the oligonucleotides of the present invention target the No. 2 intron RNA of the TCF4 gene as RNAi drugs, they will not affect the protein expression level of TCF4 in theory. In order to confirm whether the drug treatment has an impact on the expression level of the TCF4 protein, this Examples are verified. B4G12 cells were transiently transfected with random sequence control or RNAi-13 drug, and the protein level of TCF4 was detected by Western Blot 24 hours later. Compared with random sequence control, RNAi-13 drug treatment did not significantly change the protein expression of TCF4 ( Figure 4 A).

[0...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of biological medicines, and discloses oligonucleotide and an application thereof. The oligonucleotide is a nucleotide of which the consistency with any one of nucleotide sequences shown in SEQ ID NO: 1 to SEQ ID NO: 20 is not lower than 80%. The invention proves that the oligonucleotide targeting the intron 2 of the TCF4 gene is used as RNAi drug to treat, so that the aggregation of the mutated toxic intron RNA of the TCF4 can be obviously reduced, but the mRNA and protein expression of the normal TCF4 are not obviously influenced. The RNAi drug treatment provided by the invention can relieve corneal dystrophy caused by RNA aggregation and accumulation due to TCF4 mutation, moreover, the RNAi medicine not only can prevent deterioration of corneal dystrophy caused by TCF4 mutation, but also can play a role in preventing diseases caused by TCF4 mutation.

Description

technical field [0001] The present invention relates to the technical field of biomedicine, and more specifically relates to an oligonucleotide and its application. Background technique [0002] Corneal dystrophy (Corneal dystrophy, referred to as CD) is a group of hereditary, usually progressive ophthalmic diseases, which originate in the cornea and only invade a certain layer of the cornea at the beginning; in the late stage, it can spread to adjacent layers, or even affect the whole thickness of the cornea; drugs Treatment is ineffective. Those who affect vision can be treated with corneal transplantation. [0003] According to the anatomical location, it is divided into three categories: anterior, stromal, and posterior. Usually the posterior aspect is more severe and accounts for the greatest proportion of patients (endothelial corneal dystrophy). The vast majority of CDs have corneal opacities of various shapes. CD has been studied for many years, but the mechanism...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/113C12N15/864A61K9/00A61K31/7088A61K47/46A61P27/02
CPCC12N15/113C12N15/86A61K9/0048A61K9/0019A61K31/7088A61K47/46A61P27/02C12N2310/14C12N2320/30C12N2750/14143
Inventor 李斌任盛
Owner WUHAN NEUROPHTH BIOTECHNOLOGY LTD CO
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap