Hemoglobinopathy treatment effectiveness prediction method

A technology for hemoglobinopathy and fetal hemoglobin, which is applied in blood diseases, gene therapy, genetic active ingredients, etc., can solve the problems of complex and harmful fetal hemoglobin expression mechanism, and achieve the effect of reducing the risk of failure or weakening of effectiveness.

Pending Publication Date: 2020-11-17
EDIGENE GUANGZHOU INC
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] Although the BCL11A erythroid enhancer site has been clinically implemented, that is, the clinical Phase 1 / 2 trial of autologous hematopoietic stem cell transplantation developed by gene editing technology for the treatment of β-thalassemia and sickle cell anemia (Clinicaltrials.gov code is NCT03655678, NCT03745287, NCT03432364), but due to individual differences among patients, the degree of regulation of BCL11A gene on HbF has different effects in different patients. The BCL11A gene inhibits the expression of HbF, then editing the BCL11A erythroid enhancer to increase HbF to treat patients may fail, and if the patient has undergone chemotherapy to clear the bone marrow and immune system, this will cause unpredictable potential harm
Moreover, the mechanism for regulating the expression of γ-globin and HbF fetal hemoglobin is very complicated, and it is difficult to predict the effectiveness of treatment methods in advance by detecting the expression of a certain gene or several genes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Hemoglobinopathy treatment effectiveness prediction method
  • Hemoglobinopathy treatment effectiveness prediction method
  • Hemoglobinopathy treatment effectiveness prediction method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0270] 1. Use of modified TR cells for the preparation of a medicament for use in a method of treating a hemoglobinopathy in an individual, said method comprising:

[0271] a) An assessment step comprising assessing the ability of a first population of modified CD34-positive hematopoietic stem / progenitor cells ("CD34-positive HSPCs") to produce desired levels of gamma-globulin or fetal hemoglobin (HbF) following differentiation , wherein the first population of modified CD34-positive HSPCs is derived from said individual and modified to reduce BCL11A function ("modified EV cells"); and

[0272] b) a treatment step comprising administering to said individual a second population of modified CD34-positive HSPCs derived from said individual and modified to reduce BCL11A function ("modified TR cells ").

[0273] 2. Use of modified TR cells for the manufacture of a medicament for use in a method of treating a hemoglobinopathy in an individual, said method comprising a treatment ste...

Embodiment 1

[0322] Example 1: Gene Editing of Hematopoietic Stem Cell BCL11A Enhancer

[0323] This example involves using the CRISPR / Cas9 system to gene-edit thalassemia (hereinafter referred to as thalassemia) patients and healthy donors to mobilize the BCL11A erythroid enhancer site of CD34-positive hematopoietic stem cells derived from peripheral blood.

[0324]Using the "CRISPR RGEN TOOLS" software to design sgRNA targeting the BCL11A (+58) site and synthesize two chemically modified sgRNAs, the sequence information is as follows: sgRNA-1: ctaacagttgcttttatcac (SEQ ID NO: 5), sgRNA-2: atcagaggccaaacccttcc SEQ ID NO:4. Cas9 mRNA编码序列信息如下:gacaagaagtacagcatcggcctggacatcggcaccaactctgtgggctgggccgtgatcaccgacgagtacaaggtgcccagcaagaaattcaaggtgctgggcaacaccgaccggcacagcatcaagaagaacctgatcggagccctgctgttcgacagcggcgaaacagccgaggccacccggctgaagagaaccgccagaagaagatacaccagacggaagaaccggatctgctatctgcaagagatcttcagcaacgagatggccaaggtggacgacagcttcttccacagactggaagagtccttcctggtggaagaggataagaagcacgagcggcaccccatcttc...

Embodiment 2

[0333] Example 2 Expression of γ-globin mRNA and erythroid differentiation-related proteins

[0334] This experiment verified the expression of γ-globin (HBG gene) mRNA after differentiation of gene-edited hematopoietic stem cells derived from peripheral blood mobilized from thalassemia patients and healthy donors.

[0335] 2.1 Red blood cell differentiation

[0336] The electroporation conditions of 300v 1ms were selected, and Cas9 mRNA and sgRNA-1, Cas9 mRNA and sgRNA-2 were respectively electroporated into 5 thalassemia patients and 2 healthy donors to mobilize hematopoietic stem cells derived from peripheral blood. Cells in the control group had no electroporation step. Afterwards, erythroid differentiation experiments were performed using the "two-step" differentiation protocol described below.

[0337] The first step in the "two-step method" differentiation is to use the hematopoietic stem cell erythroid expansion and differentiation medium to induce the differentiatio...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for treating hemoglobinopathy in an individual. The method comprises the following steps: (a), an evaluation step; the evaluation step comprises the process of evaluating the ability to generate the required level of gamma-globulin or fetal hemoglobin after differentiation of a first population of modified CD34 positive hematopoietic stem / progenitor cells, whereinthe first population of modified CD34 positive HSPC is derived from the individual and modified to reduce the BCL11A function; and (b), a treatment step; the treatment step comprises the process of administering a second population of modified CD34 positive HSPC to the individual; and the modified CD34 positive HSPC is derived from the individual and modified to reduce the BCL11A function. Meanwhile, the invention also relates to a method for treating hemoglobinopathy in the individual, a method of selecting an individual suffering from hemoglobinopathy for treatment with the second population of modified CD34 positive HSPC, and a method of determining whether an individual suffering from hemoglobinopathy is suitable or not suitable for treatment with the second population of modified CD34 positive HSPC derived from the individual and modified to reduce the BCL11A function.

Description

technical field [0001] This application relates to a concomitant prediction method for predicting the effectiveness of gene editing technology in the treatment of hemoglobinopathies. Before treating the disease, this prediction method pre-isolates CD34-positive hematopoietic stem cells from patients, uses gene editing technology to destroy the BCL11A erythroid enhancer site, and predicts the gene-edited BCL11A erythroid in advance by evaluating the degree of up-regulation of γ-globin and fetal hemoglobin expression. Enhancer effectiveness in treating hemoglobinopathies, adjunct to disease therapy. Background technique [0002] Hemoglobinopathy is a group of hereditary blood diseases caused by abnormal hemoglobin molecular structure or abnormal globin peptide chain synthesis. The two main disease types in hemoglobinopathies are beta-thalassemia and sickle cell anemia. The pathogenesis of β-thalassemia is due to gene mutations in the β-globin peptide chain. Most patients hav...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): A61K48/00A61K35/28A61P7/06C12Q1/02
CPCA61K48/005A61K35/28A61P7/06G01N33/5005
Inventor方日国于玲玲杨卉慧
OwnerEDIGENE GUANGZHOU INC