Construction and application of recombinant saccharomyces cerevisiae for synthesizing carminic acid

A technology of carminic acid and Saccharomyces cerevisiae, which is applied in the field of genetic engineering and bioengineering, and can solve the problems of lack of application

Active Publication Date: 2020-11-24
JIANGNAN UNIV
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is still a lack of application of the safe strain of Saccharomyces cerevisiae in the production of carminic acid

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and application of recombinant saccharomyces cerevisiae for synthesizing carminic acid
  • Construction and application of recombinant saccharomyces cerevisiae for synthesizing carminic acid
  • Construction and application of recombinant saccharomyces cerevisiae for synthesizing carminic acid

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1: Construction of gene expression cassettes related to carminic acid synthesis pathway

[0050] Using the ZhuI synthetic sequence (nucleotide sequence as shown in SEQ ID NO.3) as a template, design primer pair F1 / R1, carry out PCR amplification with the primer pair, and use Primer Star MasterMix high-fidelity pfu enzyme to carry out, the condition is pre- Denaturation at 95°C, 3min; 30 cycles of amplification, according to 95°C, 10s, 55°C, 10s, 72°C, 30s; extension at 72°C, 5min, the PCR product was purified to obtain the fragment ZhuI; the vector pY26 was used as Template, F2 / R2 was amplified by PCR with primers, and the product was purified. The fragment ZhuI and the vector pY26 were recombined by the Gibson assembly method to obtain a recombinant vector, the recombinant vector was transformed into Escherichia coli JM109, the plasmid was extracted and verified by sequencing, and the correct recombinant vector pY26-zhuI was obtained.

[0051] Using the zhuJ s...

Embodiment 2

[0059] Example 2: Construction of carminic acid synthesis pathway carrier A

[0060]Using the vector pMD19T-pINO1-OKS-tPGK1 constructed in Example 1 as a template, F19 / R19 was amplified by PCR with primers, and the PCR product was purified to obtain the fragment pINO1-OKS-tPGK1; pMD19T-pTDH1-UGT2-ter-pGAL7 was used as a template, PCR amplification was performed on F20 / R20 with primers, and the PCR product was purified to obtain the fragment pTDH1-UGT2-ter-pGAL7; pY26-zhuI constructed in Example 1 -ZhuJ is used as a template, the primer pair F21 / R21 is used for PCR amplification, and the PCR product is purified to obtain the vector fragment pY26-zhuI-ZhuJ. The fragments pINO1-OKS-tPGK1, pTDH1-UGT2-ter-pGAL7 and the vector pY26-zhuI-ZhuJ were recombined by the Gibson assembly method to obtain the recombinant vector, and the recombinant vector was transformed into Escherichia coli JM109 and sequenced to verify that the correct recombinant vector pY26 was obtained -CA pathway A (...

Embodiment 3

[0063] Example 3: Construction of carminic acid synthesis pathway carrier B

[0064] Using the pMD19T-aptC-tVPS13 constructed in Example 1 as a template, PCR amplification was performed on F22 / R22 with primers to obtain the fragment aptC-tVPS13; using pY26-CA pathway A as a template, PCR amplification was performed on F23 / R23 with primers The linearized vector pY26-CA pathway A was obtained. The fragment aptC-tVPS13 and the vector pY26-CA pathway A were recombined by the Gibson assembly method to obtain the recombinant vector, and the recombinant vector was transformed into Escherichia coli JM109 and sequenced to verify that the correct recombinant vector pY26-CA pathway B (pY26-zhuI -ZhuJ-pINO1-OKS-tPGK1-pTDH1-UGT2-ter-pGAL7-aptC-tVPS13) (see figure 2 ).

[0065] Primers used in Table 3

[0066] Primer Sequence 5'-3' (the underlined part is the homology arm region) F22 TCCCTCAAAA ATGACTTTGCCAGTTTTGATTATTGGTG

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses construction and application of recombinant saccharomyces cerevisiae for synthesizing carmine acid, and belongs to the technical field of gene engineering and biological engineering. The method comprises the following steps of heterologously expressing OKS of cyclase zhuI, aromatase zhuJ and Octaketide synthase 1, C-glucosyltransferase UGT2, monooxygenase aptC and 4'-phosphopantetheine transferase npgA in saccharomyces cerevisiae, thereby obtaining the recombinant saccharomyces cerevisiae capable of synthesizing the carmine acid. The recombinant saccharomyces cerevisiaecan be used for synthesizing carmine acid by taking acetyl-CoA and malonyl-CoA synthesized on the basis of the recombinant saccharomyces cerevisiae as precursors, so that the recombinant saccharomyces cerevisiae plays an important role in the fields of cosmetics, textiles and foods.

Description

technical field [0001] The invention relates to the construction and application of a recombinant Saccharomyces cerevisiae for synthesizing carminic acid, belonging to the technical fields of genetic engineering and bioengineering. Background technique [0002] Pigments extracted from insects, especially scale insects, have been used by humans since ancient times for textile dyeing, cosmetics and paints, and food coloring. The most commonly used scale insect dyes include kermesic acid, laccaic acids, and carminic acids, which have a red hue due to their similar chromophore structures. These compounds were reported to be mainly produced by five species of distantly related scale insects (Hemiptera), namely, Porphyria (Armenian / Arat cochineal), Cochineal, Poronica polyphylla (Polisik elegans), Dacropis (Mexican cochineal) and Lac insect (Indian lac), these insects have been used by humans to produce scale insect dyes on a large scale at different times and in different region...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12N15/81C12N15/90C12P17/06C12R1/865
CPCC12N15/81C12N15/905C12N9/12C12N9/1029C12N9/1051C12N9/0004C12P17/06C12N9/0071C12N9/1085C12N9/93C12N1/18C07K14/395C12P7/66C12R2001/66C12R2001/865C12P19/18C12Y207/08007C12Y203/01C12Y114/14C12Y204/01C12Y114/14001C12N1/185C12N15/815C12Y207/00
Inventor周景文张倩高松陈坚曾伟主堵国成
OwnerJIANGNAN UNIV