BHLH transcription factor for promoting anthocyanin synthesis in lotus and application thereof
A technology of transcription factors and anthocyanins, applied in the field of molecular biology, can solve the problems of insufficient improvement of lotus flower color molecular breeding, achieve the effect of enriching theoretical understanding and promoting molecular breeding
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Cloning of NnTT8 Gene from Lotus Flower
[0023] Through comparative transcriptomics methods, a bHLH transcription factor gene whose expression level was up-regulated during the flower bud coloring process of the safflower cultivar 'Yehonglian' at different developmental stages was named NnTT8. Total RNA (ribonucleic acid) was extracted from the fresh petals of 'Yehonglian' and reverse-transcribed into cDNA. The CDS sequence of NnTT8 was obtained by PCR amplification with specific primer pair NnTT8-F: ATGGCTGCACCAGTGAGTAATCGCC and NnTT8-R: CATGAATTCATTTATAATTTGGTGT. The PCR reaction system is 50 μL, and the components include: 2×PrimeSTAR Max DNA Polymerase 25 μL, upstream and downstream primers 2 μL each, cDNA 1 μL, ddH 2 O 20 μL. The PCR program was: 35 cycles of 98°C for 10s, 60°C for 15s, and 72°C for 15s. The cloned NnTT8 sequence was sequenced to determine its complete CDS sequence.
Embodiment 2
[0025] Preparation of recombinant plasmid containing NnTT8 gene and recombinant genetically engineered bacteria.
[0026] Using the product obtained in Example 1 as a template, using a pair of specific primers: (The underlined part is the homologous sequence at the end of the upstream vector, and the italic part is the AscI restriction site) and (The underlined part is the homologous sequence at the end of the downstream vector, and the italicized text part is the SpeI restriction site). Perform PCR amplification. The PCR reaction system and procedure are consistent with those in Example 1. After recovering the PCR product, the II One Step Cloning Kit, using homologous recombination to connect to the PMDC83 vector that has been digested with AscI and SpeI, and sequenced to verify that the recombinant plasmid containing the NnTT8 gene was obtained. Then, the plasmid was introduced into the GV3101 Agrobacterium strain, thereby obtaining an engineering bacterium containing a...
Embodiment 3
[0028] Verification of NnTT8 gene function
[0029] The Arabidopsis tt8 mutant was selected to verify the function of NnTT8 gene.
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap