Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of construction method of mutyh gene conditional knockout mouse model

A technology of mouse model and construction method, applied in other methods of inserting foreign genetic materials, genetic engineering, biochemical equipment and methods, etc., can solve the problems of reduced genome stability and unclarified molecular mechanism of heart failure, etc., and achieve stable good sex effect

Active Publication Date: 2021-11-02
SIR RUN RUN HOSPITAL NANJING MEDICAL UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

MUTYH1 and MUTYH2 are involved in oxidative damage repair of mtDNA and nuclear genome, respectively, and their dysfunction will lead to reduced genome stability
MUTYH mutation is a risk factor for diseases related to energy metabolism disorders, but so far, the function of Mutyh gene expression products and the molecular mechanism of gene mutations leading to heart failure have not yet been elucidated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of construction method of mutyh gene conditional knockout mouse model
  • A kind of construction method of mutyh gene conditional knockout mouse model
  • A kind of construction method of mutyh gene conditional knockout mouse model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1. Construction of Mutyh gene selective knockout mouse model:

[0038] 1. According to the sequence on both sides of the exon 3-15 of the mouse Mutyh gene (knockout gene name (NCBI number): 70603), design gRNA based on the CRISPR / Cas9 system and conduct gRNA activity test in vitro, such as figure 1 Shown, the gRNA sequence of described Mutyh gene is as follows:

[0039] The recognition site of the sequence on the side of exon 3 (SEQ NO.1): 5'—CTAAGATCAGAAATTTGGTC—3'

[0040] The recognition site of the sequence on the side of exon 15 (SEQ NO.2): 5'—TGAGTAGCTTTCCTTCAGCTT—3'

[0041] 2. According to the principle of homologous recombination, flox modification is carried out to Mutyh gene in vitro, homologous recombination carrier (Donorvector), the DNA sequence of the flox modification site of described Mutyh gene is as follows:

[0042]The recognition site of the sequence on the side of exon 3 (SEQ NO.3): 5'—ATAACTTCGTATAATGTATGCTATACGAAGTTAT—3'

[0043] The recogniti...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a Mutyh gene conditional knockout mouse model. The Mutyh gene is modified with flox by using CRISPR / Cas9 technology and the principle of homologous recombination, and the flox mouse is mated with a specific Cre tool mouse Finally, exons 3-15 of the Mutyh gene can be knocked out to obtain model mice with gene tissue or cell-specific knockouts. The mutation of the MUTYH gene may become a risk factor for the occurrence of diseases related to energy metabolism disorders by inducing mitochondrial dysfunction. Myocardial energy metabolism disorder is an important factor that causes and promotes the occurrence and development of heart failure. The Mutyh gene conditional knockout mouse model of the invention has good stability, and provides an economical, simple and reliable animal model for further research on the pathogenesis of heart failure and gene therapy.

Description

technical field [0001] The invention relates to a method for constructing a mouse model, in particular to a method for constructing a Mutyh gene conditional knockout mouse model. Background technique [0002] Chronic heart failure is the final outcome of the development of various cardiovascular diseases, clinically characterized by hypofunction of the heart and various arrhythmias. Cardiac remodeling is the most important pathophysiological basis for the progression of various cardiovascular diseases to chronic heart failure. How to prevent cardiac remodeling is the key and difficulty in the treatment of various cardiovascular diseases. [0003] Mitochondria are the main site of energy production in cardiomyocytes. Sustained stress on mitochondria produces reactive oxygen species (ROS), which causes oxidative damage to mitochondrial DNA (mtDNA) and mitochondrial proteins; increased ROS enters a vicious circle, which will lead to the accumulation of abnormal mtDNA and damag...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/85C12N15/90A01K67/027
CPCA01K67/0276A01K67/0278A01K2207/15A01K2217/072A01K2217/075A01K2227/105A01K2267/0375C12N15/113C12N15/8509C12N15/907C12N2310/20
Inventor 高伟鲁翔王丽赵璨王玥
Owner SIR RUN RUN HOSPITAL NANJING MEDICAL UNIV