A kind of construction method of mutyh gene conditional knockout mouse model
A technology of mouse model and construction method, applied in other methods of inserting foreign genetic materials, genetic engineering, biochemical equipment and methods, etc., can solve the problems of reduced genome stability and unclarified molecular mechanism of heart failure, etc., and achieve stable good sex effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] 1. Construction of Mutyh gene selective knockout mouse model:
[0038] 1. According to the sequence on both sides of the exon 3-15 of the mouse Mutyh gene (knockout gene name (NCBI number): 70603), design gRNA based on the CRISPR / Cas9 system and conduct gRNA activity test in vitro, such as figure 1 Shown, the gRNA sequence of described Mutyh gene is as follows:
[0039] The recognition site of the sequence on the side of exon 3 (SEQ NO.1): 5'—CTAAGATCAGAAATTTGGTC—3'
[0040] The recognition site of the sequence on the side of exon 15 (SEQ NO.2): 5'—TGAGTAGCTTTCCTTCAGCTT—3'
[0041] 2. According to the principle of homologous recombination, flox modification is carried out to Mutyh gene in vitro, homologous recombination carrier (Donorvector), the DNA sequence of the flox modification site of described Mutyh gene is as follows:
[0042]The recognition site of the sequence on the side of exon 3 (SEQ NO.3): 5'—ATAACTTCGTATAATGTATGCTATACGAAGTTAT—3'
[0043] The recogniti...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


