Antigen peptide bridged with integration factor 1 and antibody thereof, and application of antibody
An antigen peptide and antibody technology, applied in the biological field, can solve the problems of no detection antibody and inconvenience, and achieve the effect of good specificity, good immunogenicity and high titer
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] The preparation of embodiment 1 rabbit polyclonal antibody (anti-Amphiphysin I N278 antibody)
[0029] The antigenic peptides (Ac-CGLEKQHGSN, Ac-CTVKAQPSDN) used in this example were obtained by artificial chemical synthesis (Nanjing GenScript Biotechnology Co., Ltd.). The synthesized antigenic peptides were identified by mass spectrometry, and purified and identified by HPLC after correct identification.
[0030] The above antigenic peptides were coupled to the carrier protein KLH to obtain antigenic peptide-KLH conjugates, and the antigenic peptide-KLH conjugates were used as immunogens to immunize New Zealand rabbits to prepare polyclonal antibodies. Specific steps are as follows:
[0031] (1) Animal blood was collected before the experiment, and pre-immune serum was prepared. After the collected blood is centrifuged, the supernatant is collected to obtain the serum.
[0032] (2) Initial immunization: Each rabbit was subcutaneously injected with a mixture of 1 mL ...
Embodiment 2
[0037] Embodiment 2 detects antibody titer
[0038] (1) Dissolve the uncrosslinked antigen peptide in the coating solution (0.05M carbonate buffer pH 9.6) at 4 μg / mL.
[0039] (2) Add 100 μL of the coating solution dissolved in (1) to the 96-well ELISA plate overnight at 4°C.
[0040] (3) The next day, empty the liquid and pat dry the residual liquid, add the washing liquid every 5 minutes, and rinse three times;
[0041] (4) Add 150 μL of blocking solution to each well and incubate at 37° C. for 1 h.
[0042] (5) Empty the liquid and pat dry the residual liquid, rinse with washing liquid three times.
[0043] (6) Add 100 μL of anti-Bridging Integrator 1N277 antibody or anti-Bridging Integrator 1N288 antibody diluted in gradient to each well, and incubate at 37°C for 1 hour.
[0044] (7) Empty the liquid and pat dry the residual liquid, rinse with washing liquid three times.
[0045] (8) Add horseradish peroxidase-labeled goat anti-rabbit IgG secondary antibody (1 mg / mL) d...
Embodiment 3
[0049] Example 3 Cytological Detection of Anti-Bridging Integrator 1N277 Antibody and Anti-Bridging Integrator 1N288 Antibody Specificity
[0050] (1) Construction of a plasmid expressing GFP-tagged Bridging Integrator 1 (GFP-BIN1): Using the human brain cDNA library as a template, the Bridging Integrator 1 gene sequence was amplified using primers FP and RP, and the Bridging Integrator 1 gene sequence was amplified by connecting and transforming DH5α. The Integrator 1 gene was connected to the pEGFP-C2 vector with the GFP tag, and a plasmid expressing Bridging Integrator 1 with the GFP tag was constructed. Among them, the sequences of primers FP and RP are as follows:
[0051] FP: GGAAGATCTCGATGGCAGAGATGGGCAG;
[0052] RP: GCGGGATCCTCATGGGACCCTTCAGTG.
[0053] (2) Cell transfection: The plasmid expressing GFP-tagged Bridging Integrator 1 (GFP-BIN1) was transfected into HEK293 cells.
[0054] (3) Sample preparation: 2 days after cell transfection, collect cells, wash them w...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


