Unlock instant, AI-driven research and patent intelligence for your innovation.

Antigen peptide bridged with integration factor 1 and antibody thereof, and application of antibody

An antigen peptide and antibody technology, applied in the biological field, can solve the problems of no detection antibody and inconvenience, and achieve the effect of good specificity, good immunogenicity and high titer

Active Publication Date: 2021-04-16
WUHAN UNIV
View PDF4 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, there is no antibody for detecting Bridging Integrator 1 (1-277) and (1-288) fragments produced by AEP cleavage in the brain, which brings great inconvenience to related research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antigen peptide bridged with integration factor 1 and antibody thereof, and application of antibody
  • Antigen peptide bridged with integration factor 1 and antibody thereof, and application of antibody
  • Antigen peptide bridged with integration factor 1 and antibody thereof, and application of antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The preparation of embodiment 1 rabbit polyclonal antibody (anti-Amphiphysin I N278 antibody)

[0029] The antigenic peptides (Ac-CGLEKQHGSN, Ac-CTVKAQPSDN) used in this example were obtained by artificial chemical synthesis (Nanjing GenScript Biotechnology Co., Ltd.). The synthesized antigenic peptides were identified by mass spectrometry, and purified and identified by HPLC after correct identification.

[0030] The above antigenic peptides were coupled to the carrier protein KLH to obtain antigenic peptide-KLH conjugates, and the antigenic peptide-KLH conjugates were used as immunogens to immunize New Zealand rabbits to prepare polyclonal antibodies. Specific steps are as follows:

[0031] (1) Animal blood was collected before the experiment, and pre-immune serum was prepared. After the collected blood is centrifuged, the supernatant is collected to obtain the serum.

[0032] (2) Initial immunization: Each rabbit was subcutaneously injected with a mixture of 1 mL ...

Embodiment 2

[0037] Embodiment 2 detects antibody titer

[0038] (1) Dissolve the uncrosslinked antigen peptide in the coating solution (0.05M carbonate buffer pH 9.6) at 4 μg / mL.

[0039] (2) Add 100 μL of the coating solution dissolved in (1) to the 96-well ELISA plate overnight at 4°C.

[0040] (3) The next day, empty the liquid and pat dry the residual liquid, add the washing liquid every 5 minutes, and rinse three times;

[0041] (4) Add 150 μL of blocking solution to each well and incubate at 37° C. for 1 h.

[0042] (5) Empty the liquid and pat dry the residual liquid, rinse with washing liquid three times.

[0043] (6) Add 100 μL of anti-Bridging Integrator 1N277 antibody or anti-Bridging Integrator 1N288 antibody diluted in gradient to each well, and incubate at 37°C for 1 hour.

[0044] (7) Empty the liquid and pat dry the residual liquid, rinse with washing liquid three times.

[0045] (8) Add horseradish peroxidase-labeled goat anti-rabbit IgG secondary antibody (1 mg / mL) d...

Embodiment 3

[0049] Example 3 Cytological Detection of Anti-Bridging Integrator 1N277 Antibody and Anti-Bridging Integrator 1N288 Antibody Specificity

[0050] (1) Construction of a plasmid expressing GFP-tagged Bridging Integrator 1 (GFP-BIN1): Using the human brain cDNA library as a template, the Bridging Integrator 1 gene sequence was amplified using primers FP and RP, and the Bridging Integrator 1 gene sequence was amplified by connecting and transforming DH5α. The Integrator 1 gene was connected to the pEGFP-C2 vector with the GFP tag, and a plasmid expressing Bridging Integrator 1 with the GFP tag was constructed. Among them, the sequences of primers FP and RP are as follows:

[0051] FP: GGAAGATCTCGATGGCAGAGATGGGCAG;

[0052] RP: GCGGGATCCTCATGGGACCCTTCAGTG.

[0053] (2) Cell transfection: The plasmid expressing GFP-tagged Bridging Integrator 1 (GFP-BIN1) was transfected into HEK293 cells.

[0054] (3) Sample preparation: 2 days after cell transfection, collect cells, wash them w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an antigen peptide bridged with an integration factor 1 and an antibody thereof, and application of the antibody, belonging to the technical field of biology. The antigen peptide provided by the invention is an antigen peptide of an amphoteric protein 1 (1-278) or (1-288) fragment, and the amino acid sequence of the antigen peptide is CGLEKQHGSN or CTVKAQPSDN. The antibody prepared by taking the antigen peptide as an antigen can specifically recognize the bridging integration factor 1 (1-278) or (1-288) fragment, does not recognize the full length of the bridging integration factor 1, can be used for detecting the shearing degree of the bridging integration factor 1 in human brain specimens and animal specimens, and is applicable to research on the pathogenesis of the Alzheimer's disease, early diagnosis of the Alzheimer's disease and the like.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an antigenic peptide bridging integrator 1, an antibody and application thereof. Background technique [0002] Alzheimer's disease (AD) is the most common clinical neurodegenerative disease and the most common cause of dementia in the elderly. The prevalence rate of the elderly over 60 years old is as high as 5%, which brings a heavy burden to the society and family [1,2]. But so far, the cause of the onset of AD is still unclear, so there is also a lack of treatment measures targeting the pathogenesis and delaying the course of the disease. [0003] Bridging Integrator 1 (BIN1) is the most important susceptibility locus of late-onset AD except APOE. Bridging Integrator 1 is a regulator of multiple cellular functions, including endocytosis and membrane cycling, regulation of the cytoskeleton, DNA repair, cell cycle progression, and apoptosis [3]. However, the mechanism...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/47C07K16/18G01N33/68
Inventor 张振涛
Owner WUHAN UNIV