Check patentability & draft patents in minutes with Patsnap Eureka AI!

A method for improving methanol biotolerance and biotransformation efficiency of bacterial strains

A biotransformation, tolerance technology that can address issues such as toxicity in microbe-based methods, methods using microbes, biochemical equipment and methods, etc.

Active Publication Date: 2022-04-01
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, methanol, as an organic solvent, has certain toxicity to microbial cells, so it is urgent to improve the tolerance of bacterial strains to high concentrations of methanol

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for improving methanol biotolerance and biotransformation efficiency of bacterial strains
  • A method for improving methanol biotolerance and biotransformation efficiency of bacterial strains

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Embodiment 1 introduces cgl2365 gene missense mutation in Corynebacterium glutamicum MX-11

[0063] Strain C.glutamicum MX-11 was obtained from literature (Tuyishima, P., Wang, Y., Fan, L., Zhang, Q., Li, Q., Zheng, P., Sun, J., Ma, Y., 2018. Engineering Corynebacterium glutamicum formethanol-dependent growth and glutamate production. Metab. Eng. 49, 220-231).

[0064] (1) Construction of pK18mobsacB-tet-cgl2365 C542G plasmid

[0065] a. Linearize pK18mobsacB-tet empty vector using BamHI endonuclease.

[0066] b. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotide cgl2365-F1 (TATGACATGATTACGAATTCCAGCTGGGGCAGCGTTGAG; SEQ ID NO: 1) and cgl2365-R1 (CATCCCACCGTGGGCAAGCAGACA; SEQ ID NO: 2) as primers to amplify The upper half fragment of cgl2365, while introducing a mutation from C to G at the 542nd base of cgl2365.

[0067] c. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotide c...

Embodiment 2

[0076] Embodiment 2 introduces cgl2857 gene synonymous mutation in Corynebacterium glutamicum MX-11

[0077] (1) Construction of pK18mobsacB-tet-cgl2857 G183A plasmid

[0078] a. Linearize pK18mobsacB-tet empty vector using BamHI endonuclease.

[0079] b. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotide cgl2857-F1 (TATGACATGATTACGAATTCTGCCGAGCGTTTTCATCCAACTG; SEQ ID NO: 7) and cgl2857-R1 (CTTCGGAATCGTCCGCGCCTGACCAGTCAC; SEQ ID NO: 8) as primers to amplify The upper half fragment of cgl2857, while introducing a mutation from base G to A at the 183rd base of cgl2857.

[0080] c. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotide cgl2857-F2 (GCGCGGACGATTCCGAAGGATTTGGATCT; SEQ ID NO: 9) and cgl2857-R2 (CGACGGCCAGTGCCAAGCTTCGGCCAAAAACTTGGAAGGCC; SEQ ID NO: 10) as primers to amplify The lower half fragment of cgl2857, while introducing a mutation from base 183 of cgl2857 from G to A. ...

Embodiment 3

[0089] Embodiment 3 methanol biotransformation

[0090] (1) culture medium

[0091] In glucose-free CGXII medium, methanol and xylose were added as carbon sources, and 1 mM isopropylthiogalactopyranoside (IPTG), 5 mg / L chloramphenicol and 25 mg / L kanamycin were additionally added. CGXII medium formula refers to literature (Keilhauer, C., Eggeling, L., Sahm, H., 1993. Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvCoperon. J. Bacteriol. 175, 5595-5603).

[0092] (2) Culture conditions

[0093] C. glutamicum strain MX-11, MX-11-cgl2365 C542G , MX-11-cgl2857 G183A They were respectively inoculated in shake flasks containing the above-mentioned medium, and the initial OD600nm was about 0.5 (the initial dry cell weight was about 0.153gCDW / L). The shaker flask was cultured in a shaker at a temperature of 30°C and a rotation speed of 220rpm. The size of the shaker flask was 250mL, and the liquid volume was 50mL. The shaker flask was sea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for constructing a bacterial strain with improved methanol tolerance by mutating the cgl2365 gene and / or the cgl2857 gene in the bacterial strain. The invention also discloses the constructed methanol biotransformation strain with improved methanol tolerance and a method for utilizing the strain to carry out methanol biotransformation. When the bacterial strain constructed by the present invention utilizes the mixed carbon source composed of methanol and other auxiliary carbon sources, the utilization ratio of methanol is significantly increased, thereby substantially improving the methanol utilization efficiency of the bacterial strain.

Description

technical field [0001] The present invention relates to the field of biotechnology. Specifically, the present invention relates to a method for improving the methanol biotolerance and biotransformation rate of bacterial strains, the bacterial strain obtained by the method, and the application of the method and the obtained bacterial strain in biotransformation of methanol. Background technique [0002] Methanol is the primary platform product of coal chemical industry, shale gas chemical industry and industrial and agricultural waste gasification. my country's methanol production capacity has reached 80 million tons per year, accounting for more than 50% of the international total, showing a trend of excess. The development of methanol economy urgently needs supporting facilities The methanol conversion and utilization technology [Chen Jijun, Chen Guangda, 2016; Zhang Shixin et al., 2013]. Biotransformation has the characteristics of diverse products, high product selectivit...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/77C12N1/21C12N1/32C12N15/31C07K14/34C12R1/15
Inventor 孙际宾王钰郑平凡立稳周文娟马延和
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More