A method for improving methanol biotolerance and biotransformation efficiency of bacterial strains
A biotransformation, tolerance technology that can address issues such as toxicity in microbe-based methods, methods using microbes, biochemical equipment and methods, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Embodiment 1 introduces cgl2365 gene missense mutation in Corynebacterium glutamicum MX-11
[0063] Strain C.glutamicum MX-11 was obtained from literature (Tuyishima, P., Wang, Y., Fan, L., Zhang, Q., Li, Q., Zheng, P., Sun, J., Ma, Y., 2018. Engineering Corynebacterium glutamicum formethanol-dependent growth and glutamate production. Metab. Eng. 49, 220-231).
[0064] (1) Construction of pK18mobsacB-tet-cgl2365 C542G plasmid
[0065] a. Linearize pK18mobsacB-tet empty vector using BamHI endonuclease.
[0066] b. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotide cgl2365-F1 (TATGACATGATTACGAATTCCAGCTGGGGCAGCGTTGAG; SEQ ID NO: 1) and cgl2365-R1 (CATCCCACCGTGGGCAAGCAGACA; SEQ ID NO: 2) as primers to amplify The upper half fragment of cgl2365, while introducing a mutation from C to G at the 542nd base of cgl2365.
[0067] c. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotide c...
Embodiment 2
[0076] Embodiment 2 introduces cgl2857 gene synonymous mutation in Corynebacterium glutamicum MX-11
[0077] (1) Construction of pK18mobsacB-tet-cgl2857 G183A plasmid
[0078] a. Linearize pK18mobsacB-tet empty vector using BamHI endonuclease.
[0079] b. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotide cgl2857-F1 (TATGACATGATTACGAATTCTGCCGAGCGTTTTCATCCAACTG; SEQ ID NO: 7) and cgl2857-R1 (CTTCGGAATCGTCCGCGCCTGACCAGTCAC; SEQ ID NO: 8) as primers to amplify The upper half fragment of cgl2857, while introducing a mutation from base G to A at the 183rd base of cgl2857.
[0080] c. Using the genomic DNA of C. glutamicum ATCC 13032 as a template, using single-stranded nucleotide cgl2857-F2 (GCGCGGACGATTCCGAAGGATTTGGATCT; SEQ ID NO: 9) and cgl2857-R2 (CGACGGCCAGTGCCAAGCTTCGGCCAAAAACTTGGAAGGCC; SEQ ID NO: 10) as primers to amplify The lower half fragment of cgl2857, while introducing a mutation from base 183 of cgl2857 from G to A. ...
Embodiment 3
[0089] Embodiment 3 methanol biotransformation
[0090] (1) culture medium
[0091] In glucose-free CGXII medium, methanol and xylose were added as carbon sources, and 1 mM isopropylthiogalactopyranoside (IPTG), 5 mg / L chloramphenicol and 25 mg / L kanamycin were additionally added. CGXII medium formula refers to literature (Keilhauer, C., Eggeling, L., Sahm, H., 1993. Isoleucine synthesis in Corynebacterium glutamicum: molecular analysis of the ilvB-ilvN-ilvCoperon. J. Bacteriol. 175, 5595-5603).
[0092] (2) Culture conditions
[0093] C. glutamicum strain MX-11, MX-11-cgl2365 C542G , MX-11-cgl2857 G183A They were respectively inoculated in shake flasks containing the above-mentioned medium, and the initial OD600nm was about 0.5 (the initial dry cell weight was about 0.153gCDW / L). The shaker flask was cultured in a shaker at a temperature of 30°C and a rotation speed of 220rpm. The size of the shaker flask was 250mL, and the liquid volume was 50mL. The shaker flask was sea...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


