Compound for treating optic nerve diseases as well as preparation method and application thereof
A complex and optic nerve technology, applied in the field of biomedicine, can solve the problems of no disclosure of the protective effect of DNA tetrahedron on optic nerve, no compound use, and no disclosure of the use of miR-22, so as to achieve good application prospects and promote release Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Embodiment 1, the synthesis of the complex (tFNA-miR22) of tFNA and miR-22
[0049] 1. Synthesis
[0050] Dissolve the four DNA single strands (S1, S2, S3-miR22, S4) in TM Buffer (10mM Tris-HCl, 50MmMgCl2, pH=8.0), the final concentration of the four DNA single strands is 1000nM, mix well, and heat rapidly to Keep the temperature at 95°C for 10 minutes, then quickly cool down to 4°C and keep it for more than 20 minutes to obtain tFNA-miR22.
[0051] The sequences of the four single strands (5'→3') are as follows:
[0052] S1:
[0053] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA
[0054] (SEQ ID NO.1)
[0055] S2:
[0056] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG
[0057] (SEQ ID NO.2)
[0058] S3-miR22-3p:
[0059] AAGCUGCCAGUUGAAGAACUGU-TTTTT-ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC
[0060] S4:
[0061] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG
[0062] (SEQ ID NO.4)
...
experiment example 1
[0070] Experimental example 1. Uptake of tFNA-miR22 by damaged retinal ganglion cells
[0071] 1. Experimental method
[0072] 1.1 Test the optimal modeling concentration (in vitro simulation of optic ganglion cell injury)
[0073] RGC-5 cells (a mouse retinal ganglion cell) were cultured in groups in 96-well plates, 1*10 per well 4 cells. Each group was treated with different concentrations of N-methyl-D-aspartic acid (NMDA) for 1 hour, and the complete medium was changed to continue culturing for 24 hours, and then the cell viability was detected by CCK-8 experiment, and the drug inhibition rate of 4mM NMDA was found is about 40%, so 4mM is selected as the optimal modeling concentration (such as Figure 6 :A-B).
[0074] 1.2 Test the optimal concentration of anti-cell damage drugs (cell proliferation experiment)
[0075] RGC-5 cells were cultured in groups in 96-well plates, 1*10 per well 4 cells. After adding 4nM NMDA to each experimental group except the blank group...
PUM
Property | Measurement | Unit |
---|---|---|
particle diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com