Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Compound for treating optic nerve diseases as well as preparation method and application thereof

A complex and optic nerve technology, applied in the field of biomedicine, can solve the problems of no disclosure of the protective effect of DNA tetrahedron on optic nerve, no compound use, and no disclosure of the use of miR-22, so as to achieve good application prospects and promote release Effect

Active Publication Date: 2021-05-28
CHENGDU GENREZE GENE TECH CO LTD
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Chinese patent CN109806275A discloses the use of DNA tetrahedron to promote the proliferation, differentiation and / or migration of neural stem cells, but does not disclose the effect of DNA tetrahedron on optic nerve protection
Romano et al disclosed that miR-22 is a predictive target gene for glaucoma, however, the use of miR-22 as a target gene for treatment of glaucoma has not been disclosed (Romano GL, Platania CB, Forte S, Salomone S, Drago F, Bucolo C. MicroRNA target prediction in glaucoma. Prog Brain Res. 2015; 220:217-40.)
[0007] To sum up, there are still no relevant reports on the use of DNA tetrahedron or miR-22 in the treatment of glaucoma, let alone the combined use of the two as optic nerve protection drugs to treat glaucoma.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compound for treating optic nerve diseases as well as preparation method and application thereof
  • Compound for treating optic nerve diseases as well as preparation method and application thereof
  • Compound for treating optic nerve diseases as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Embodiment 1, the synthesis of the complex (tFNA-miR22) of tFNA and miR-22

[0049] 1. Synthesis

[0050] Dissolve the four DNA single strands (S1, S2, S3-miR22, S4) in TM Buffer (10mM Tris-HCl, 50MmMgCl2, pH=8.0), the final concentration of the four DNA single strands is 1000nM, mix well, and heat rapidly to Keep the temperature at 95°C for 10 minutes, then quickly cool down to 4°C and keep it for more than 20 minutes to obtain tFNA-miR22.

[0051] The sequences of the four single strands (5'→3') are as follows:

[0052] S1:

[0053] ATTTATCACCCGCCATAGTAGACGTATCACCAGGCAGTTGAGACGAACATTCCTAAGTCTGAA

[0054] (SEQ ID NO.1)

[0055] S2:

[0056] ACATGCGAGGGTCCAATACCGACGATTACAGCTTGCTACACGATTCAGACTTAGGAATGTTCG

[0057] (SEQ ID NO.2)

[0058] S3-miR22-3p:

[0059] AAGCUGCCAGUUGAAGAACUGU-TTTTT-ACTACTATGGCGGGTGATAAAACGTGTAGCAAGCTGTAATCGACGGGAAGAGCATGCCCATCC

[0060] S4:

[0061] ACGGTATTGGACCCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCG

[0062] (SEQ ID NO.4)

...

experiment example 1

[0070] Experimental example 1. Uptake of tFNA-miR22 by damaged retinal ganglion cells

[0071] 1. Experimental method

[0072] 1.1 Test the optimal modeling concentration (in vitro simulation of optic ganglion cell injury)

[0073] RGC-5 cells (a mouse retinal ganglion cell) were cultured in groups in 96-well plates, 1*10 per well 4 cells. Each group was treated with different concentrations of N-methyl-D-aspartic acid (NMDA) for 1 hour, and the complete medium was changed to continue culturing for 24 hours, and then the cell viability was detected by CCK-8 experiment, and the drug inhibition rate of 4mM NMDA was found is about 40%, so 4mM is selected as the optimal modeling concentration (such as Figure 6 :A-B).

[0074] 1.2 Test the optimal concentration of anti-cell damage drugs (cell proliferation experiment)

[0075] RGC-5 cells were cultured in groups in 96-well plates, 1*10 per well 4 cells. After adding 4nM NMDA to each experimental group except the blank group...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
particle diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a compound tFNA-miR22 for treating optic nerve diseases. The compound tFNA-miR22 is composed of a DNA tetrahedron and miR22 according to the molar ratio of 1:(1-4). The tFNA-miR22 disclosed by the invention can be used for effectively inhibiting the apoptosis of the retinal ganglion cells and promoting the release of brain-derived neural factors (BDNF), so that the tFNA-miR22 has a good protection effect on the retinal ganglion cells. The tFNA-miR22 is used for preparing the optic nerve protection medicine, treatment of neurodegenerative optic nerve diseases including glaucoma is facilitated, and the tFNA-miR22 has a very good application prospect.

Description

technical field [0001] The invention belongs to the field of biomedicine, and in particular relates to a compound for treating optic nerve diseases, a preparation method and application thereof. Background technique [0002] Glaucoma is a group of diseases that threaten and damage the optic nerve and its visual pathway, leading to visual dysfunction. It is the world's first irreversible blinding eye disease. Primary open-angle glaucoma is a special type of optic nerve disease characterized by progressive damage to retinal ganglion cells (RGCs) and their axons, with characteristic optic atrophy and visual field defects . The onset of glaucoma is often hidden, and the progress is relatively slow. Generally, there are no obvious symptoms in the early stage, and the visual field gradually narrows until blindness. There are nearly 21 million glaucoma patients in my country, which may produce nearly 6.3 million blind people and more than 10 million visually handicapped people. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K31/711A61K31/7105A61P27/06A61P25/02
CPCA61K31/711A61K31/7105A61P27/06A61P25/02A61K2300/00C12N15/113C12N2310/151C12N2310/3519C12N2310/141
Inventor 林云锋李佳杰蔡潇潇
Owner CHENGDU GENREZE GENE TECH CO LTD
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More