Unlock instant, AI-driven research and patent intelligence for your innovation.

Antigen spectrum expanded O-type foot and mouth disease virus strain as well as construction method and application thereof

A technology of foot-and-mouth disease virus and construction method, which is applied in the field of antigen spectrum expansion of O-type foot-and-mouth disease virus strains and its construction, and can solve problems such as unclear impact

Active Publication Date: 2021-07-02
LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI
View PDF10 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although G-H loop substitutions between different serotypes have been reported to increase FMDV cross-reactivity, the effect of G-H loop substitutions within O serotypes on FMDV cross-reactivity has been unclear so far.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Antigen spectrum expanded O-type foot and mouth disease virus strain as well as construction method and application thereof
  • Antigen spectrum expanded O-type foot and mouth disease virus strain as well as construction method and application thereof
  • Antigen spectrum expanded O-type foot and mouth disease virus strain as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Construction method of FMDV recombinant full-length clone

[0057] Take the half-length plasmid pSK-Z123 of FMDV O / HN / CHA / 93 vaccine strain (the plasmid is disclosed in the article Evaluation of genetically modified foot-and-mouth disease virus vaccine candidate generated by reverse genetics, Li et al. BMC Veterinary Research 2012 ,8:57) as the backbone, respectively designed and synthesized the plasmid pSK-Z123NXVP1 containing the current epidemic strain O / NXYCh / CHA / 2018VP1 gene, and the chimeric vaccine strain O / HB / Plasmid pSK-Z123NXVP1G-H of the HK / 99G-H loop gene (about 90 nucleotides). The above two plasmids were digested with Spe I and Bgl II enzymes respectively, and the target bands of about 5400bp were recovered respectively, and inserted into the plasmid pOFS digested with the same enzymes (this plasmid was found in the article Evaluation of a genetically modified foot-and-mouth disease virus vaccine As disclosed in candidate generated by reversegenetics, Li...

Embodiment 2

[0061] Rescue of recombinant virus

[0062] Plasmids pOFS / NXVP1 and pOFS / NXVP1 / G-H were linearized with Not I enzyme, and then purified and recovered with a DNA fragment recovery kit as transfection templates. When the conventionally cultured monolayer BSR / T7 cells grow to 70%-80%, liposome Lipofectamine TM 2000-mediated transfection (see the operating instructions for the specific operation method). 6 h after transfection, 2 mL of DMEM medium (Invitrogen) containing 8% fetal bovine serum was added, and placed at 37°C in 5% CO 2 The incubator continued to cultivate, and the cells were observed for cytopathic occurrence. The cells were harvested 72 hours after transfection, and after repeated freezing and thawing for 2 to 3 times, they were continuously passaged on BHK-21, and the viruses of each passage were preserved below -70 passages for future use.

[0063] The results of transfection showed that after transfection of BSR / T7 cells with the two plasmids for 60 hours, typ...

Embodiment 3

[0065] Identification of recombinant virus

[0066] 3.1, RT-PCR

[0067] Get the supernatant of transfection prepared in Example 2, use RNAasy Mini Kit to extract cytotoxic total RNA respectively, use primer OZ3136 (+) and OZ3980 (-) primer pair (OZ3136 (+): AGATAACACACGGGAAAGCC, SEQ ID NO:3 , OZ3980(-):TGCATCTGGTTGATGGTGTC, SEQ ID NO:4) was amplified by RT-PCR to obtain the VP1 gene fragment, which was purified and recovered by the kit and sent to Shanghai Sonny Co., Ltd. for sequencing to verify the correctness of the recombinant virus.

[0068] Table 1 RT-PCR reaction system

[0069]

[0070] The reaction system was placed in a constant temperature water bath at 42°C for 90 minutes, and the RT-PCR amplification reaction was performed after the reaction was completed. The amplification program was as follows: denaturation at 94°C for 2 min; 30 cycles of 98°C for 20 s and 68°C for 3 mins; extension at 72°C for 8 min.

[0071] The sequencing results showed that both rHN / ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an antigen spectrum expanded O-type foot and mouth disease virus strain as well as a construction method and application thereof, and belongs to the technical field of veterinary drug biological products. The rHN / NXVP1 / G-H takes a recombinant virus rHN / NXVP1 as a skeleton and is embedded with a G-H ring antigen epitope gene of O / HB / HK / 99; the recombinant virus is obtained by embedding a VP1 gene of O / NXYCh / CHA / 2018 on the basis of O / HN / CHA / 93. The O / HN / CHA / 93 and the rHN / NXVP1 are not matched with Cathay pedigree virus antigens, the rHN / NXVP1 / G-H can be highly matched with PanAsia, Mya98 and Ind-2001 pedigree virus antigens and can also be matched with the Cathay pedigree virus antigens, the antigen spectrum of the foot and mouth disease virus is expanded through replacement of a G-H ring, and the prepared inactivated vaccine can be used for preventing and controlling O-type multi-pedigree FMDV prevalence.

Description

technical field [0001] The invention belongs to the technical field of veterinary drug biological products, and in particular relates to an antigen spectrum expanded O-type foot-and-mouth disease virus strain and a construction method and application thereof. Background technique [0002] Foot-and-Mouth Disease (FMD) is a severe infectious disease caused by Foot-and-Mouth Disease Virus (FMDV) which infects pigs, cattle, sheep and other major domestic animals and wild cloven-hoofed animals. The disease spreads rapidly, has a high incidence rate, and is extremely harmful. Therefore, the International Office of Epizootics (OIE) lists it as the first of the must-reported diseases, and my country stipulates it as a first-class animal infectious disease. There are 7 serotypes of FMDV, A, O, C, Asia1, SAT1, SAT2 and SAT3. There is no cross-protection between types, but there are differences in cross-protection within the type. In recent years, O-type FMD is still seriously endange...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/42C12N15/85A61K39/135A61P31/14C12R1/93
CPCC12N7/00C12N15/85C07K14/005A61K39/12A61P31/14C12N2770/32121C12N2770/32122C12N2770/32134A61K2039/552Y02A40/70Y02A50/30
Inventor 李平花刘在新卢曾军黄书伦查晶晶李冬白兴文孙普马雪青曹轶梅付元芳李坤袁红张婧
Owner LANZHOU INST OF VETERINARY SCI CHINESE ACAD OF AGRI SCI