Antigen spectrum expanded O-type foot and mouth disease virus strain as well as construction method and application thereof
A technology of foot-and-mouth disease virus and construction method, which is applied in the field of antigen spectrum expansion of O-type foot-and-mouth disease virus strains and its construction, and can solve problems such as unclear impact
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Construction method of FMDV recombinant full-length clone
[0057] Take the half-length plasmid pSK-Z123 of FMDV O / HN / CHA / 93 vaccine strain (the plasmid is disclosed in the article Evaluation of genetically modified foot-and-mouth disease virus vaccine candidate generated by reverse genetics, Li et al. BMC Veterinary Research 2012 ,8:57) as the backbone, respectively designed and synthesized the plasmid pSK-Z123NXVP1 containing the current epidemic strain O / NXYCh / CHA / 2018VP1 gene, and the chimeric vaccine strain O / HB / Plasmid pSK-Z123NXVP1G-H of the HK / 99G-H loop gene (about 90 nucleotides). The above two plasmids were digested with Spe I and Bgl II enzymes respectively, and the target bands of about 5400bp were recovered respectively, and inserted into the plasmid pOFS digested with the same enzymes (this plasmid was found in the article Evaluation of a genetically modified foot-and-mouth disease virus vaccine As disclosed in candidate generated by reversegenetics, Li...
Embodiment 2
[0061] Rescue of recombinant virus
[0062] Plasmids pOFS / NXVP1 and pOFS / NXVP1 / G-H were linearized with Not I enzyme, and then purified and recovered with a DNA fragment recovery kit as transfection templates. When the conventionally cultured monolayer BSR / T7 cells grow to 70%-80%, liposome Lipofectamine TM 2000-mediated transfection (see the operating instructions for the specific operation method). 6 h after transfection, 2 mL of DMEM medium (Invitrogen) containing 8% fetal bovine serum was added, and placed at 37°C in 5% CO 2 The incubator continued to cultivate, and the cells were observed for cytopathic occurrence. The cells were harvested 72 hours after transfection, and after repeated freezing and thawing for 2 to 3 times, they were continuously passaged on BHK-21, and the viruses of each passage were preserved below -70 passages for future use.
[0063] The results of transfection showed that after transfection of BSR / T7 cells with the two plasmids for 60 hours, typ...
Embodiment 3
[0065] Identification of recombinant virus
[0066] 3.1, RT-PCR
[0067] Get the supernatant of transfection prepared in Example 2, use RNAasy Mini Kit to extract cytotoxic total RNA respectively, use primer OZ3136 (+) and OZ3980 (-) primer pair (OZ3136 (+): AGATAACACACGGGAAAGCC, SEQ ID NO:3 , OZ3980(-):TGCATCTGGTTGATGGTGTC, SEQ ID NO:4) was amplified by RT-PCR to obtain the VP1 gene fragment, which was purified and recovered by the kit and sent to Shanghai Sonny Co., Ltd. for sequencing to verify the correctness of the recombinant virus.
[0068] Table 1 RT-PCR reaction system
[0069]
[0070] The reaction system was placed in a constant temperature water bath at 42°C for 90 minutes, and the RT-PCR amplification reaction was performed after the reaction was completed. The amplification program was as follows: denaturation at 94°C for 2 min; 30 cycles of 98°C for 20 s and 68°C for 3 mins; extension at 72°C for 8 min.
[0071] The sequencing results showed that both rHN / ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


