Technology for intervening and blocking virus reverse transcription transposition based on CRISPR-Cas13a

A technology of retrotransposition and reverse transcription, applied in the field of virology, can solve the problem of lack of test models for detecting retroviruses

Active Publication Date: 2021-10-22
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In summary, in this field, although there have been many applications of gene editing using Cas9, further research and exploration are urgently needed in terms of virus suppression, especially the suppression of retroviruses such as HIV, so as to develop more effective antiviral drug
In addition, there is a lack of test models for intracellular transposition of retrotranscribing organisms in the art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Technology for intervening and blocking virus reverse transcription transposition based on CRISPR-Cas13a
  • Technology for intervening and blocking virus reverse transcription transposition based on CRISPR-Cas13a
  • Technology for intervening and blocking virus reverse transcription transposition based on CRISPR-Cas13a

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0083] Embodiment 1, expression CRISPR-Cas13a protein in eukaryotic cell

[0084] The establishment of the cell expression system expressing CRISPR-Cas13a protein, and the method for expressing CRISPR-Cas13a protein in eukaryotic cells are as follows:

[0085] 1. Construct the vector pDUAL-HFF1-LshCas13a expressing LshCas13a protein

[0086] Such as figure 1 As shown, use C2C2-NcoI-P5 (sequence is TATGCATCACCACCATCATCATCATATGGGGAACCTGTTCGGACACAAG (SEQ ID NO: 1)) and C2C2-NcoI-P3 primer (sequence is TCATCGTCGTCCTTGTAGTCCATGGTTACAGGGTATCGTTAGTATTCT (SEQ ID NO: 2)) to carry out PCR amplification, from the pC001 plasmid Amplify the LshCas13a coding sequence fragment; insert it into the pDUAL-HFF1 plasmid to obtain the recombinant plasmid pDUAL-HFF1-LshCas13a.

[0087] 2. Plasmid transformation

[0088] Linearize pDUAL-HFF1-LshCas13a and transform the linearized fragment into fission yeast. Using the lithium acetate / PEG / heat shock method, 500ng of linear pDUAL-HFF1-LshCas13a fr...

Embodiment 2

[0091] Embodiment 2, expressing the gRNA targeting the CRISPR-Cas13a of the retrotransposon Tf1 RNA intermediate in eukaryotic cells

[0092] After repeated research, the inventors optimized the gRNA targeting the Tf1 RNA intermediate, targeting the Gag gene of Tf1, the gene sequence is as follows (SEQ ID NO: 12):

[0093] 5’-atgaaaaactcatcacagaaaagaattcgaatggatggaaatggtggatattgtactcaagatgatatttcagatatccttaagcattttgtaaatcaaaccacccgccatgtggaaacgtatagaaaaggcatggatatggaagagttcatcgttaaattaagaacattttttggtgaacattccgatagatattcaactgaacagtctaaaagactgtacgctatagaacgacttgaatcaagagatcaaaattatgctaataaaatcttttgtcaagattcttctcttacttgggatgaact a ttaagaagaatggtaaacctagttggatctgatgaagaagaaaggttgactaa a acctttttgaaacttaagaatgataaggacaaggtactattcattaagaaagtactctatgaagataatttaagtgagaaacgagtcagattatatctactatggatgcttccaccctatctgattaaacagagaggtgattcttactgggacatggataaaaatatagacaagatttttaactttgtaccagataaaggtgaaacgataattgaacgctacaccaaacctaggaatcttttaaaaacaaagactggaagcaattggaaaaacaataagtttttaaaggagaacgacac...

Embodiment 3

[0112] Example 3, CRISPR-Cas13a interferes with retrotransposon Tf1RNA intermediate effect test in eukaryotic cells such as fission yeast

[0113] In this example, the above-mentioned established model system based on CRISPR-Cas13a intervention to block viral retrotransposition was used to verify the effect of interfering with transposition.

[0114] The experimental operation steps are as follows:

[0115] 1. On the MM+thiamine (Thiamine; 10 μM) plate, culture the transgenic fission yeast cells (3 types in total) established in the preceding examples that integrate the expression of LshCas13a protein and free expression of gRNA-Tf1 plasmid, and cultivate them at 32° C. for 4 days. Thiamine can inhibit the transposition of Tf1 initiated by nmt1 promoter.

[0116] 2. Qualitative determination of transposition activity of retrotransposon Tf1

[0117] (1) Pick a single clone from the MM+Thiamine plate, streak it onto the PMG+Thiamine (10μM) plate and incubate for 3 days;

[01...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a technology for intervening and blocking reverse transcription transposition of a reverse transcription organism based on CRISPR-Cas13a. The invention discloses a technology for intervening and blocking reverse transcription transposition of the reverse transcription organism based on CRISPR-Cas13a, a system for blocking reverse transcription transposition of the reverse transcription organism in eukaryotic cells and application of the system. In the invention, research and demonstration are carried out on the basis of the model system of the retrovirus Tf1. According to the technical scheme, Cas13a is used for inhibiting reverse transcription transposition for the first time, and the reverse transcription transposition blocking efficiency of Cas13a is ideal.

Description

technical field [0001] The invention belongs to the field of virology, and more specifically, the invention relates to a technology based on CRISPR-Cas13a intervention to block viral retrotransposition. Background technique [0002] CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) is a regularly clustered interspaced short palindromic repeat, which is an acquired immunity method in most bacteria and archaea. In recent years, many molecular tools that use the CRISPR system to knock out genes or introduce mutations in genes have been successfully developed, but tools that can knock out genes or edit genes at the RNA level are also urgently needed. [0003] Currently, CRISPR has been applied as a tool for research against exogenous retroviral pathogens and inactivation of endogenous retroviruses in organ transplantation. CRISPR-Cas9 is a system designed to combat animal and plant retroviral pathogens. CRISPR-Cas9 can effectively inactivate potential HIV-1 in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/79C12N15/65C12N15/90C12N15/81
CPCC12N15/113C12N15/79C12N15/65C12N15/815C12N15/902C12N2310/20
Inventor李轩荆新云张牛冰朱艳
OwnerCAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI