Colloidal gold immunochromatography test paper card for detecting African swine fever virus antibody

A technology of African swine fever virus and immunochromatographic test paper, which is applied in the field of immune detection, and achieves the effects of easy promotion and use, high practical value, and high sensitivity

Active Publication Date: 2021-11-30
CHINA AGRI UNIV +1
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patented technology allows us to quickly identify any bacteria called Swinburne disease (SFT) by testing them with specialized reagents attached onto various surfaces like plates or paper strips. These tests are highly sensitive but have only limited effectiveness when used alone due to their poor detection ability at low concentrations compared to other methods such as ELISA. However, this method could potentially benefit crop rotation programs through its potential benefits over traditional techniques.

Problems solved by technology

This patents discuss various aspects related to this problem: The technical problem addressed in these documents relates to developing effective testing tools for Africa Swine Fever virus due its ability to cause serious harmful outbreaks even without precautions like strict social safety regulations. Current anti-swine fetal monoclonal antisera diagnosis technologies involve expensive processes and cannot provide quick responses during emergency situations.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Colloidal gold immunochromatography test paper card for detecting African swine fever virus antibody
  • Colloidal gold immunochromatography test paper card for detecting African swine fever virus antibody
  • Colloidal gold immunochromatography test paper card for detecting African swine fever virus antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1: the preparation of recombinant antigen of the present invention

[0035] 1. Preparation of recombinant expression strain of African swine fever virus capsid protein P72 trimer

[0036] Based on the analysis of bioinformatics and structural biology methods, the present invention redesigns the African swine fever capsid protein P72, and synthesizes the p72 (strep-tag) gene sequence of the African swine fever virus by a chemical synthesis method. The p72 gene, yeast GAL1 promoter and ADH1 terminator were constructed on the plasmid to form the P72 protein gene expression cassette. The P72 protein gene expression cassette with homologous recombination arms was amplified by PCR as a repair template. Using CRISPR-Cas9 technology, the gRNA that recognizes GGATTTAGGAATCCATAAAA was co-expressed, and the P72 protein gene expression cassette was inserted into the multi-copy Ty2 retrotransposon of Saccharomyces cerevisiae through homologous recombination to achieve mu...

Embodiment 2

[0049] Embodiment 2: Colloidal gold immunochromatography detection test paper card for preparing African swine fever virus antibody

[0050] 1. Preparation of gold-labeled conjugates of African swine fever virus capsid protein P72 monomer labeled with gold particles by electrostatic adsorption

[0051] Take 40nm colloidal gold particles and adjust the pH to 7.5 with 0.1 mol / L NaOH solution, add 10ug African swine fever virus capsid protein P72 monomer, mix quickly and mix well at room temperature on a 3D rotator for 30min, then add a final concentration of 1% BSA And mix on a 3D rotary mixer for 30 minutes, centrifuge the gold standard solution at 12000 r / min at 4 °C for 10 minutes, carefully discard the supernatant, wash the precipitate twice with 0.01mol / L PBS buffer, and centrifuge again. The precipitate is the purified gold-labeled complex. The prepared colloidal gold-labeled African swine fever virus capsid protein P72 monomer is resuspended in 0.01mol / L PBS and stored at...

Embodiment 3

[0058] Embodiment 3: colloidal gold immunochromatography test paper card specificity test

[0059] Cross-test the known porcine circovirus antibody-positive serum, porcine blue ear virus antibody-positive serum, porcine pseudorabies virus antibody-positive serum, swine fever virus antibody-positive serum and African swine fever virus antibody-positive serum, the results are shown in figure 2 .

[0060] figure 2 The results showed that only the African swine fever virus antibody-positive serum sample had a positive reaction with the detection line, but when it reacted with several other sera, the detection line had no color development and a negative reaction, indicating that the antigen was used to detect African swine fever virus antibodies. Antibodies to CSFV are highly specific.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical field of immunodetection, and discloses a colloidal gold immunochromatography test paper card for detecting an African swine fever virus antibody. According to the immunochromatography test paper card for detecting the African swine fever virus antibody, an African swine fever virus capsid protein P72 monomer is sprayed on a marker pad, a P72 trimer is sprayed on a T line, and the prepared test paper card has extremely high sensitivity; meanwhile, the test paper card further has extremely high specificity and accuracy, the result is visual and can be judged by naked eye, and the test paper card is capable of rapidly and specifically detecting the African swine fever virus antibody in serum, high in practical value and convenient to popularize and use in grassroots.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap