Overexpression SIRT6 recombinant lentivirus plasmid vector and construction method of cell model of overexpression SIRT6 recombinant lentivirus plasmid vector

A recombinant lentivirus and plasmid vector technology, applied in the fields of medical molecular biology and genetic engineering, to achieve the effect of inhibiting endothelial cell apoptosis, stable and persistent high expression, and improving cardiovascular disease

Pending Publication Date: 2022-07-29
ZHONGSHAN HOSPITAL FUDAN UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is currently a lack of effective intervention targets for the treatment of cardiovascular-related diseases by targeting endothelial cell apoptosis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Overexpression SIRT6 recombinant lentivirus plasmid vector and construction method of cell model of overexpression SIRT6 recombinant lentivirus plasmid vector
  • Overexpression SIRT6 recombinant lentivirus plasmid vector and construction method of cell model of overexpression SIRT6 recombinant lentivirus plasmid vector
  • Overexpression SIRT6 recombinant lentivirus plasmid vector and construction method of cell model of overexpression SIRT6 recombinant lentivirus plasmid vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0057] Embodiment 1, obtain SIRT6 DNA double bond fragment

[0058] The SIRT6 protein coding region (Coding sequence, CDS) of the gene involved in the present invention is obtained from the transcript NM_001193285 of the human SIRT6 gene in the NCBI GenBank database (www.ncbi.nlm.nih.gov / gene). The nucleotide sequence of the CDS region is shown in SEQ ID NO: 1, and the full length of the sequence is 983 bp, and the amino acid sequence of the encoded protein is shown in SEQ ID NO: 2.

[0059] 1. Design SIRT6 DNA double-stranded fragments

[0060] The inventors of the present invention obtained the SIRT6 protein coding region sequence (SEQ ID NO: 1) as follows by searching the NCBI GenBank database (www.ncbi.nlm.nih.gov / gene) for the transcript NM_001193285 of the human SIRT6 gene:

[0061] ATGTCGGTGAATTACGCGGCGGGGCTGTCGCCGTACGCGGACAAGGGCAAGTGCGGCCTCCCGGAGATCTTCGACCCCCCGGAGGAGCTGGAGCGGAAGGTGTGGGAACTGGCGAGGCTGGTCTGGCAGTCTTCCAGTGTGGTGTTCCACACGGGTGCCGGCATCAGCACTGCCTCTGGCATCCCCGACT...

Embodiment 2

[0067] Example 2. Construction of SIRT6 overexpression lentiviral vector and identification of its overexpression effect

[0068] 1. Vector enzyme digestion and fragment ligation

[0069] Add each of the following reagents in sequence: 1 μl carrier DNA (1 μg / μl), 4 μl 10*buffer, 32 μl ddH20, 1.5 μl EcoRI, 1.5 μl BamHI, gently pipette and mix, and react in a water bath at 37°C for 1-2 hours. The vector plasmid was digested. After digestion, agarose gel electrophoresis was performed to recover the target fragment. In the HB infusionTM one-step cloning ligation system, the SIRT6 DNA double-stranded target fragment was ligated into the pHBLV-CMV-MCS-3flag-EF1-puro vector after digestion to obtain a SIRT6 overexpression recombinant lentiviral vector.

[0070] 2. Preparation of virus concentrate

[0071] Referring to the instructions of LipofiterTM transfection reagent (Shanghai Hanheng Biotechnology Co., Ltd.), 10 μg of the SIRT6 overexpression recombinant lentiviral vector obta...

Embodiment 3

[0088] Example 3. Effect of SIRT6 overexpression on oxidative stress-induced apoptosis and autophagy of human microvascular endothelial cells HMEC-1

[0089] 1. Modeling of oxidative stress in human microvascular endothelial cells HMEC-1

[0090] The SIRT6-overexpressing HMEC-1 stable cell line and the control cell line constructed in Example 2 were incubated in 5% CO. 2 , 95%N 2 , after culturing in serum-free medium for 12 hours, change to fresh medium containing 10% fetal bovine serum FBS, at a concentration of 400uM H 2 O 2 cultured for 6 hours under the conditions.

[0091] 2. To verify the changes of SIRT6-overexpressed HMEC-1 in oxidative stress-induced apoptosis and autophagy biomarkers (Bax and Beclin-1) by RT-qPCR:

[0092] 2.1 Acquisition of cDNA

[0093] RNA extraction kit (Vazymel) was used to extract the RNA of HMEC-1 infected with the expression control virus concentrate and SIRT6 overexpression virus concentrate, respectively. The reverse transcription rea...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an overexpression SIRT6 recombinant lentiviral plasmid vector and a construction method of a cell model of the overexpression SIRT6 recombinant lentiviral plasmid vector. The nucleotide sequence of a gene SIRT6 protein coding region of an SIRT6 DNA double-chain fragment in the recombinant lentiviral plasmid vector is as shown in SEQ ID NO: 1; by utilizing the recombinant lentiviral vector, stable and continuous high expression of SIRT6 is realized, autophagy of endothelial cells is remarkably promoted, apoptosis is inhibited, and the functions of the endothelial cells are maintained, so that a new hope is brought for clinically intervening the functions of the endothelial cells so as to improve cardiovascular diseases; a potential molecular mechanism between SIRT6 and endothelial apoptosis and autophagy can be further researched subsequently, and a useful clue is provided for treating cardiovascular diseases caused by endothelial dysfunction; the important application value is realized.

Description

technical field [0001] The invention relates to the technical fields of medical molecular biology and genetic engineering, in particular to a method for constructing a recombinant lentiviral plasmid vector overexpressing SIRT6 and a cell model thereof. Background technique [0002] At present, despite the rapid development of major treatments in recent years, cardiovascular disease is still a disease with high mortality worldwide, so there is an urgent need to find new treatments and interventions to treat cardiovascular disease and improve prognosis. The maintenance of the normal function of vascular endothelial cells is crucial for vascular health and the prevention and treatment of cardiovascular disease. The imbalance of endothelial cell apoptosis has been confirmed to be an important initiating factor for the damage of the vascular endothelial barrier, and is closely related to the occurrence and development of various cardiovascular diseases such as atherosclerosis, my...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N15/66C12N5/10C12N15/54
CPCC12N15/86C12N15/66C12N9/1029C12N5/069C12N2740/15043C12N2800/107C12N2510/00
Inventor李华郭振杨葛均波
OwnerZHONGSHAN HOSPITAL FUDAN UNIV