Proteases

A technology of protease and protease activity, applied in protein food processing, protein food ingredients, hydrolytic enzymes, etc., can solve the problem of no sequence information

Inactive Publication Date: 2006-11-22
NOVOZYMES AS
View PDF90 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] DD 200432|8 discloses a proteolytic preparation derived from Nocardiopsis dassonvillei strain ZIMET 43647, but no sequence information

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Proteases
  • Proteases
  • Proteases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment approach

[0236] In alternative embodiments, the term "alter" is used instead of "substitute" as a general term for alteration in protein molecules. This alternative embodiment includes each claim to illustrate claim 1, and specifically includes anything described herein, such as definitions (except definitions substituted), ie aspects, particular embodiments, etc.

[0237] A variant of the parent protease comprising an alteration in at least one position of at least one region selected from the group consisting of:

[0238] 6-18; 22-28; 32-39; 42-58; 62-63; 66-76; 78-100; 103-106; 111-114; 151; 155-156; 160-176; 179-181; and 184-188; of which

[0239] (a) said change is independently

[0240] (i) an amino acid insertion immediately downstream of said position,

[0241] (ii) a deletion of the amino acid occupying said position, and / or

[0242] (iii) substitution of the amino acid occupying said position;

[0243] (b) the variant has protease activity; and

[0244] (c) each positio...

Embodiment 1

[0300] Example 1: Protease Assay

[0301] pNA assay

[0302] pNA substrate: Suc-AAPF-pNA (Bachem L-1400).

[0303] Temperature: room temperature (25°C)

[0304] Assay buffer: 100mM succinic acid, 100mM HEPES, 100mM CHES, 100mM CABS, 1mM CaCl 2 , 150 mM KCl, 0.01% Triton X-100, which was adjusted to pH 2.0, 2.5, 3.0, 3.5, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, and 12.0 with HCl or NaOH.

[0305] 20 μl protease (diluted in 0.01% Triton X-100) was mixed with 100 μl assay buffer. The assay was started by adding 100 [mu]l pNA substrate (50 mg dissolved in 1.0 ml DMSO and further diluted 45x with 0.01% TritonX-100). The increase in OD405 was monitored as a measure of protease activity.

[0306] Protazyme AK Assay

[0307] Substrate: Protazyme AK sheet (cross-linked and stained casein; from Megazyme)

[0308] Temperature: controlled (analysis temperature).

[0309] Assay buffer: 100mM succinic acid, 100mM HEPES, 100mM CHES, 100mM CABS, 1mM CaCl 2 , 150 mM KCl, 0.01% Trito...

Embodiment 2

[0311] Example 2: Preparation and detection of protease variants

[0312] Four protease variants comprising the amino acid sequence of amino acids 1-188 of SEQ ID NO: 2 (Protease 10), wherein said amino acid sequences contain the single substitutions N47D, T127R, N92K, and Q54R, respectively, as described below for variant N47D Prepared as described.

[0313] Site-directed mutagenesis was performed using the Mega-primer method as described by Sarkar and Sommer, 1990 (BioTechniques 8:404-407).

[0314] The N47D variant was constructed by using the following primers, where primer R10WT-CL29 (SEQ ID NO: 11 ) is gene specific and primer RSWT126 (SEQ ID NO: 12) is mutagenic:

[0315] R10WT-CL29: 5'CCGATTATGGAGCGGATTGAACATGCG 3' (SEQ ID NO: 11)

[0316] RSWT126: 5'GTGACCATCGGCGACGGCAGGGGCGTCTTCG 3' (SEQ ID NO: 12),

[0317] A DNA fragment of approximately 469 bp was amplified by PCR from the construct described below.

[0318] The Protease 10 DNA construct used for the amplifica...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a novel 3D structure encoding a Nocardiopsis protease, as well as to variants of parent protease homologous to Nocardiopsis proteases, preferably of improved thermostability and / or with an amended temperature activity profile. The invention also relates to DNA sequences encoding such variants, their production in a recombinant host cell, as well as methods of using the variants, in particular within the field of animal feed and detergents. The invention furthermore relates to methods of generating and preparing protease variants of amended properties.

Description

technical field [0001] The present invention relates to novel protease 3D structures, as well as variants of the parent protease, especially variants with altered properties, such as improved thermostability and / or altered temperature activity profiles. The invention also relates to the DNA sequences encoding said variants, their production in recombinant host cells, and methods of using said variants, especially in the field of animal feed and detergents. The invention also relates to methods of producing and preparing protease variants with altered properties. A preferred parent protease is a Nocardiopsis protease, such as a protease comprising the mature peptide portion of SEQ ID NO: 2, 4, 6, 8, 10, and 21 . Background technique [0002] Protease sequences derived from strains of Nocardiopsis sp. are disclosed in WO 88 / 03947, WO 01 / 58276, and DK 1996 00013 ("Protease 10," SEQ ID NOs: 1-2). [0003] JP 2003284571-A discloses the amino acid sequence and the corresponding ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/52A23J3/34C12N9/58C12N15/57
CPCA01K2217/05C12N9/52C12N9/58C12N2310/111A23K20/189C12N9/48
Inventor伦纳多·德马里亚卡斯滕·安德森拉斯·L·H·克里斯坦森索伦·F·拉森彼得·R·奥斯特加德
OwnerNOVOZYMES AS