Acylated insulin

a technology of acylated insulin and insulin, which is applied in the field of human insulin derivatives, can solve problems such as tissue inflammation at the injection site, and achieve the effect of rapid onset of action

Inactive Publication Date: 2006-02-09
HAVELUND SVEND +4
View PDF19 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0068] In another preferred embodiment, the invention relates to a method of treating diabetes in a patient in need of such a treatment comprising administering to the patient a therapeutically effective amount of an insulin derivative according to this invention together with a pharmaceutically acceptable carrier.
[0069] In another preferred embodiment, the invention relates to a method of treating diabetes in a patient in need of such a treatment comprising administering to the patient a therapeutically effective amount of an insulin derivative according to this invention, in mixture with an insulin or an insulin analogue which has a rapid onset of action, together with a pharmaceutically acceptable carrier.

Problems solved by technology

Certain drawbacks are associated with the use of insulin suspensions.
A drawback with these solutions is that the particle size distribution of the precipitate formed in the tissue on injection, and thus the timing of the medication, depends on the blood flow at the injection site and other parameters in a somewhat unpredictable manner.
A further drawback is that the solid particles of the insulin may act as a local irritant causing inflammation of the tissue at the site of injection.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Acylated insulin
  • Acylated insulin

Examples

Experimental program
Comparison scheme
Effect test

example 1

Synthesis of AlaA21 AspB3 Human Insulin Precursor from Yeast Strain yEA002 using the LaC212spx3 Signal / Leader.

[0397] The following oligonucleotides were synthesized:

#98(SEQ ID NO:3)5′-TGGCTAAGAGATTCGTTGACCAACACTTGTGCGGTTCTCACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAGTCTGACGACGCT-3′ (AspB3)#128(SEQ ID NO:4)5′-CTGCGGGCTGCGTCTAAGCACAGTAGTTTTCCAATTGGTACAAAGAACAGATAGAAGTACAACATTGTTCAACGATACCCTTAGCGTCGTCAGACTTTGG-3′ (AlaA21)#126(SEQ ID NO:5)5′-GTCGCCATGGCTAAGAGATTCGTTG-3′ (AspB3)#16(SEQ ID NO:6)5′-CTGCTCTAGAGCCTGCGGGCTGCGTCT-3′

[0398] The following Polymerase Chain Reaction (PCR) was performed using the Gene Amp PCR reagent kit (Perkin Elmer, 761 Main Avewalk, Conn. 06859, USA) according to the manufacturer's instructions. In all cases, the PCR mixture was overlayed with 100 μl of mineral oil (Sigma Chemical Co., St. Louis, Mo., USA). [0399] 2.5 μl of oligonucleotide #98 (2.5 pmol) [0400] 2.5 It of oligonucleotide #128 (2.5 pmol) [0401] 10 μl of 10×PCR buffer [0402] 16 μ...

example 2

Synthesis of AlaA21 ThrB3 Human Insulin Precursor from Yeast Strain yEA005 using the LaC212spx3 Signal / Leader.

[0412] The following oligonucleotides were synthesized:

#101(SEQ ID NO:7)5′-TGGCTAAGAGATTCGTTACTCAACACTTGTGCGGTTCTCACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAGTCTGACGACGCT-3′ (ThrB3)#128(SEQ ID NO:4)5′-CTGCGGGCTGCGTCTAAGCACAGTAGTTTTCCAATTGGTACAAAGAACAGATAGAAGTACAACATTGTTCAACGATACCCTTAGCGTCGTCAGACTTTGG-3′ (AlaA21)#15(SEQ ID NO:8)5′-GTCGCCATGGCTAAGAGATTCGTTA-3′ (ThrB3)#16(SEQ ID NO:6)5′-CTGCTCTAGAGCCTGCGGGCTGCGTCT-3′

[0413] The DNA encoding AlaA21 ThrB3 human insulin precursor was constructed in the same manner as described for the DNA encoding AlaA21 AspB3 human insulin precursor in Example 1. The DNA sequence encoding the LaC212spx3 signal / leader / AlaA21 ThrB3 human insulin precursor complex and the amino acid sequence thereof are SEQ ID NOS. 23, 24 and 25. The plasmid pEA8.1.1 was shown to contain the desired sequence, transformed into S. cerevisiae strain M...

example 3

Synthesis of GlyA21 AspB3 Human Insulin Precursor from Yeast Strain yEA007 using the LaC212spx3 Signal / Leader.

[0414] The following oligonucleotides were synthesized:

#98(SEQ ID NO:3)5′-TGGCTAAGAGATTCGTTGACCAACACTTGTGCGGTTCTCACTTGGTTGAAGCTTTGTACTTGGTTTGTGGTGAAAGAGGTTTCTTCTACACTCCAAAGTCTGACGACGCT-3′ (AspB3)#127(SEQ ID NO:9)5′-CTGCGGGCTGCGTCTAACCACAGTAGTTTTCCAATTGGTACAAAGAACAGATAGAAGTACAACATTGTTCAACGATACCCTTAGCGTCGTCAGACTTTGG-3′ (GlyA21)#126(SEQ ID NO:5)5′-GTCGCCATGGCTAAGAGATTCGTTG-3′ (AspB3)#16(SEQ ID NO:6)5′-CTGCTCTAGAGCCTGCGGGCTGCGTCT-3′

[0415] The DNA encoding GlyA21 AspB3 human insulin precursor was constructed in the same manner as described for the DNA encoding AlaA21 AspB3 human insulin precursor in Example 1. The DNA sequence encoding the LaC212spx3 signal / leader / GlyA21 AspB3 human insulin precursor complex and the amino acid sequence thereof are SEQ ID NOS. 26, 27 and 28. The plasmid pEA1.5.6 was shown to contain the desired sequence, transformed into S. cerevisiae strain MT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
pHaaaaaaaaaa
mean particle sizeaaaaaaaaaa
Login to view more

Abstract

The present invention relates to protracted human insulin derivatives in which the A21 and the B3 amino acid residues are, independently, any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys; PheB1 may be deleted; the B30 amino acid residue is (a) a non-codable, lipophilic amino acid having from 10 to 24 carbon atoms, in which case an acyl group of a carboxylic acid with up to 5 carbon atoms is bound to the ε-amino group of LysB29; or (b) the B30 amino acid residue is deleted or is any amino acid residue which can be coded for by the genetic code except Lys, Arg and Cys, in any of which cases the C-amino group of LysB29 has a lipophilic substituent; and any Zn2+ complexes thereof with the proviso that when B30 is Thr or Ala and A21 and B3 are both Asn, and PheB1 is present, then the insulin derivative is always present as a Zn2+ complex.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS [0001] This application is a continuation of pending application U.S. Ser. No. 10 / 101,454 filed on Mar. 12, 2002, which is a continuation of pending application U.S. Ser. No. 09 / 398,365 filed Sep. 17, 1999, now U.S. Pat. No. 6,869,930 issued Mar. 22, 2005, which is a divisional of U.S. Ser. No. 08 / 975,365 filed Nov. 20, 1997, now U.S. Pat. No. 6,011,007 issued Jan. 4, 2000, which is a continuation-in-part of application Ser. No. 08 / 400,256 filed Mar. 8, 1995, now U.S. Pat. No. 5,750,947, which is a continuation-in-part of Ser. No. 08 / 190,829 filed Feb. 2, 1994, now abandoned, and serial no. PCT / DK94 / 00347 filed 16 Sep. 1994, now abandoned, which claims priority under 35 U.S.C. 119 of Danish application no. 1044 / 93 filed 17 Sep. 1993, the contents of which are fully incorporated herein by reference.FIELD OF THE INVENTION [0002] The present invention relates to novel human insulin derivatives which are soluble and have a protracted profile of ac...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(United States)
IPC IPC(8): A61K38/28C07K14/62A61K38/00
CPCA61K38/00Y10S514/866C07K14/62
Inventor HAVELUND, SVENDHALSTROM, JOHNJONASSEN, IBANDERSEN, ASSERMARKUSSEN, JAN
Owner HAVELUND SVEND
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap