Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Set of Novel Oligonucleotide Primers and the Method for the Detection of Aspergillus Ochraceux Thereby

a technology of aspergillus ochraceux and primers, which is applied in the field of novel oligonucleotide primers and the detection method of aspergillus ochraceux thereby, can solve the problems of time-consuming, labor-intensive, expensive, and mycological expertise, and achieves the effects of less sensitive traditional methods, time-consuming and inconsistent, and high cos

Inactive Publication Date: 2010-01-21
SREENIVASAN ANAND +1
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0021]The main object of the present invention is to provide a PCR / multiplex PCR method for the detection of Aspergillus ochraceus group of fungi comprising the following species Aspergillus ochraceus, Aspergillus melleus, A. sulphureus, A. sclerotiorum, A. auricomus, and A. ostianus, which obviates the drawbacks detailed above. The present invention comprises primer pairs designed for amplification of 18S rRNA gene of the target organism Aspergillus ochraceus. The method also uses PCR / multiplex PCR conditions specific for the detection of 18S rRNA gene in the Aspergillus ochraceus in the pure culture and food system, making the method a very sensitive one.

Problems solved by technology

This method is time consuming, labour intensive, costly, requires facilities, and mycological expertise.
The drawbacks of these references are that no attempts have been made for specific detection of Aspergillus ochraceus species and the traditional methods are less sensitive, time-consuming and lack consistency.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Set of Novel Oligonucleotide Primers and the Method for the Detection of Aspergillus Ochraceux Thereby
  • Set of Novel Oligonucleotide Primers and the Method for the Detection of Aspergillus Ochraceux Thereby
  • Set of Novel Oligonucleotide Primers and the Method for the Detection of Aspergillus Ochraceux Thereby

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0060]An oligonucleotide primer for specific amplification of 18S rRNA gene was designed based on the sequence comparison of 18S rRNA gene sequences listed in table.1 using gene multiple sequence alignment computer software programmes DIALIGN 2.2.1 and Biological sequence alignment editor and analysis program for Windows 95 / 98 / NT (BioEdit version 5.0.9). This primer set amplifies 906 base pair (bp) fragment of the gene, the sequence of which is given below.

1. OT1F-5′ GCTAATACATGCTGAAAACCCCA 3′2. OT1R-5′ GCGGGTCATAATAGAAACACCGC 3′

[0061]Aspergillus ochraceus species were grown on semi-synthetic medium for 34 days. Sterilization of media and other solutions was by autoclaving for 20 minutes at 121° C. The 50ml potato dextrose broth (PDB) medium was inoculated with 1 ml mycelia suspension of different isolates of Aspergillus ochraceus group and other fungal species as mentioned in table.2. The flasks were incubated at ambient temperature of 26° to 28° C. under stationary conditions for ...

example 2

[0063]An oligonucleotide primer for specific amplification of 18S rRNA gene was designed based on the sequence comparison of 18S rRNA gene sequences listed in table.1 using gene multiple sequence alignment computer software programmes DIALIGN 2.2.1 and Biological sequence alignment editor and analysis program for Windows 95 / 98 / NT (BioEdit version 5.0.9). This primer set amplifies 353 base pair (bp) fragment of the 18S rDNA, the sequence of which is given below:

1. OT2F-5′ TAAATAGCCCGGTCCGCATTCG 3′2. OT2R-5′ TCCCCTGAGCCAGTCCGAA 3′

[0064]Aspergillus ochraceus species were grown on semi-synthetic medium for 3-4 days. Sterilization of media and other solutions was by autoclaving for 20 minutes at 121° C. The 50 ml potato dextrose broth (PDB) medium was inoculated with lml mycelia suspension of different isolates of Aspergillus ochraceus group and other fungal species as mentioned in table.2. The flasks were incubated at ambient temperature of 26° to 28° C. under stationary conditions for ...

example 3

[0066]The application of the primers mentioned in Example.1 and Example.2 for multiplex PCR is illustrated in this section. The primer set OT1 and OT2 amplifies 906 bp and 353 bp of 18S rRNA respectively, the sequences of which are given below. When the primer sets OT1 and OT2 are used together in multiplex PCR a product of 1532 bp is obtained as a result of amplification of DNA affected by the interaction of OT1F and OT2R primer set.

SEQ ID NO: 01OT1F-5′ GCTAATACATGCTGAAAACCCCA 3′SEQ ID NO: 02OT1R-5′ GCGGGTCATAATAGAAACACCGC 3′SEQ ID NO: 03OT2F-5′ TAAATAGCCCGGTCCGCATTCG 3′SEQ ID NO: 04OT2R-5′ TCCCCTGAGCCAGTCCGAA 3′

[0067]Aspergillus ochraceus species were grown on semi-synthetic medium for 3-4 days. Sterilization of media and other solutions was by autoclaving for 20 minutes at 121° C. The 50 ml potato dextrose broth (PDB) medium was inoculated with lml mycelia suspension of different isolates of Aspergillus ochraceus group and other fungal species as mentioned in table.2. The flasks ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
pHaaaaaaaaaa
volumeaaaaaaaaaa
volumeaaaaaaaaaa
Login to View More

Abstract

The present invention relates to a process for the detection of Aspergillus ochraceus by biotechnological approach. This invention particularly relates to the development of a process for the detection of species belonging to Aspergillus ochraceus group by PCR / multiplex PCR technique. More particularly the present invention relates to a set of novel oligonucleotide primers and the method for the detection of Aspergillus ochraceus thereby.

Description

[0001]The present invention relates to a process for the detection of Aspergillus ochraceus by biotechnological approach. This invention particularly relates to the development of a process for the detection of species belonging to Aspergillus ochraceus group by PCR / multiplex PCR technique. More particularly the present invention relates to a set of novel oligonucleotide primers and the method for the detection of Aspergillus ochraceus thereby.BACKGROUND OF INVENTION[0002]Aspergillus ochraceus group of fungi belonging to Genus Aspergillus section Circumdati are known to produce the mycotoxin ochratoxin A. Ochratoxins belong to pentaketide group of mycotoxins, which consists of isocoumarin molecule linked to phenylalanine through, amide linkage (Vander Merwe et al, 1965). Ochratoxins are known nephrotoxic agent, apart from that they have teratogenic, immunosuppressive and carcinogenic properties (Krogh, et al 1992). It has also been classified as possible human carcinogen (group 2B)...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): G01N27/26C07H21/04C12Q1/68
CPCC12Q1/6895C12Q2600/16
Inventor SREENIVASAN, ANANDEDDIYA, RATIRAO
Owner SREENIVASAN ANAND
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com