Check patentability & draft patents in minutes with Patsnap Eureka AI!

Human anti-HBsAg single-chain antibody/human antibody light chain constant region/protamine truncated recombination gene, coding protein and application

A single-chain antibody and protamine technology, which is applied in the fields of peptide/protein composition, application, gene therapy, etc., can solve the problems of low cell uptake rate, unstable siRNA or siRNA expression plasmid, and inability to target delivery, etc., to avoid Side Effects, Prolonged Intervention Effects, Prolonged Persistence Effects

Inactive Publication Date: 2008-01-09
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The emergence of RNA interference technology provides a new opportunity for the antiviral treatment of hepatitis B. However, there are still many problems in the clinical application of RNA interference technology, such as the instability of siRNA or siRNA expression plasmids in vivo, low cell uptake rate, inability to targeted delivery, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Human anti-HBsAg single-chain antibody/human antibody light chain constant region/protamine truncated recombination gene, coding protein and application
  • Human anti-HBsAg single-chain antibody/human antibody light chain constant region/protamine truncated recombination gene, coding protein and application
  • Human anti-HBsAg single-chain antibody/human antibody light chain constant region/protamine truncated recombination gene, coding protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0034] 1. Construction, expression and activity identification of expression product of ScFv-Ck-tP recombinant gene

[0035] The ScFv-Ck-tP gene constructed by the present invention includes three parts, which are respectively a single-chain antibody (ScFv15) against HBsAg antigen on the surface of HBV-infected cells, a human antibody light chain constant region and a human protamine truncated body with nucleic acid binding activity coding sequence.

[0036] (1) Design and synthesis of primers

[0037] Design corresponding PCR primers according to the sequence of the known single-chain antibody ScFv15, the primer sequence is: SP5: 5'-TTT GAGGTGCAGCTGGTGGAGTC-3';SP3:5'-TGTCTCTGGCGGTAATATCTGCTCCGGCTCTGGCTGCG TCGATTGATTTCCACCTTGG -3', SP3L: 5'-TTT GCTCCGCCTCCTTCGTCTGCGA CTTCTTTGTCTCTGGCGGTAATATCTG -3'. The coding sequence of human protamine truncated body (that is, the part marked with a horizontal line) was introduced into the 3' end primer, and the restriction sites...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A human anti-HBsAg mono-chain antibody / human antibody light chain constant region / protamine truncate recombinant gene, encoding protein and use are disclosed. The protein has antigen and nucleic acid combined activities. The process is carried out by: combining HBV siRNA with siRNA expression plasmid, transferring to HBV infectious cell specifically, and inhibiting HBV gene expression and copy. It has excellent specificity, efficiency, continuity and safety.

Description

technical field [0001] The present invention relates to gene therapy in the field of biotechnology, in particular to a recombinant gene ScFv-Ck constructed by genetic engineering methods consisting of coding sequences of human anti-HBsAg single-chain antibody, human antibody light chain constant region and protamine truncation -tP, also relates to the ScFv-Ck-tP fusion protein encoded by this gene, and the targeted delivery of siRNA, siRNA expression cassettes (siRNA expression cassettes, SECs) or siRNA expression plasmid mediated by the fusion protein in anti-HBV infection and application in the treatment of related diseases. Background technique [0002] Hepatitis B caused by hepatitis B virus (HBV) is a widespread and serious infectious disease, and it is also the most common cause of chronic liver diseases, such as liver cirrhosis and liver cancer. But the current treatment of anti-HBV and its related diseases is not satisfactory. The commonly used anti-HBV preparations...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/62C07K19/00A61K48/00A61K38/16A61P1/16C12N15/13C12N15/12
Inventor 杨安钢温伟红刘家云赵晶王涛许彦鸣贾林涛孟艳玲
Owner FOURTH MILITARY MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More