Human anti-HBsAg single-chain antibody/human antibody light chain constant region/protamine truncated recombination gene, coding protein and application
A single-chain antibody and protamine technology, which is applied in the fields of peptide/protein composition, application, gene therapy, etc., can solve the problems of low cell uptake rate, unstable siRNA or siRNA expression plasmid, and inability to target delivery, etc., to avoid Side Effects, Prolonged Intervention Effects, Prolonged Persistence Effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0034] 1. Construction, expression and activity identification of expression product of ScFv-Ck-tP recombinant gene
[0035] The ScFv-Ck-tP gene constructed by the present invention includes three parts, which are respectively a single-chain antibody (ScFv15) against HBsAg antigen on the surface of HBV-infected cells, a human antibody light chain constant region and a human protamine truncated body with nucleic acid binding activity coding sequence.
[0036] (1) Design and synthesis of primers
[0037] Design corresponding PCR primers according to the sequence of the known single-chain antibody ScFv15, the primer sequence is: SP5: 5'-TTT GAGGTGCAGCTGGTGGAGTC-3';SP3:5'-TGTCTCTGGCGGTAATATCTGCTCCGGCTCTGGCTGCG TCGATTGATTTCCACCTTGG -3', SP3L: 5'-TTT GCTCCGCCTCCTTCGTCTGCGA CTTCTTTGTCTCTGGCGGTAATATCTG -3'. The coding sequence of human protamine truncated body (that is, the part marked with a horizontal line) was introduced into the 3' end primer, and the restriction sites...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com