Method for analyzing structure composition of microorganism community by employing single-chain conformation polymorphism technique

A microbial community and technical analysis technology, applied in the field of analyzing the composition of the microbial community structure, can solve problems such as the difficulty in analyzing the biological composition and structure of the microbial community, and achieve the effect of improving operating efficiency

Inactive Publication Date: 2008-07-02
HARBIN INST OF TECH
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The purpose of the present invention is to solve the problem that the existing biological detection and analysis methods are difficult to analyze the biological composition structure of microbial communities, and provide a method for analyzing the composition of microbial community structures using single-strand conformation polymorphism technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for analyzing structure composition of microorganism community by employing single-chain conformation polymorphism technique
  • Method for analyzing structure composition of microorganism community by employing single-chain conformation polymorphism technique

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0007] Specific embodiment one: the present embodiment adopts single-strand conformation polymorphism technique to analyze the method for microbial community structure to carry out as follows: one, adopt the DNA extraction method (JIZHONG ZHOU, MARY ANN BRUNS, JAMES M. TIEDJE.DNA Recovery from Soils of Diverse Composition.APPLIED AND ENVIRONMENTALMICROBIOLOGY, 1996,62:316-322) extracts microbial community DNA; Two, PCR amplification: PCR amplification forward primer sequence is AGAGTTTGATCCTGGCTCAG, PCR amplification reverse primer sequence is TTACCGCGGCTGCTGGCA, the 5' end of the reverse primer is labeled with phosphate; 3. Enzyme digestion to remove the antisense strand: the enzyme digestion reaction system is 50 μL consisting of 5 μL 10×buffer buffer solution, 40 μL PCR amplification product and 5 μL λ nucleic acid at a concentration of 5 U / μL Composed of exonuclease, the enzyme digestion reaction system was reacted in an environment of 37 ° C for 3 to 4 hours, then the enzy...

specific Embodiment approach 2

[0016] Specific embodiment 2: The difference between this embodiment and specific embodiment 1 is: the PCR reaction program in step 2 is: preheating at 94°C for 5 minutes, first cycle of denaturation at 94°C for 40 seconds, annealing at 55°C for 40 seconds, and extension at 72°C for 60 seconds. Cycled 30 times, the annealing temperature decreased by 0.1 °C in each cycle, and finally extended at 72 °C for 10 min. Other steps and parameters are the same as those in Embodiment 1.

specific Embodiment approach 3

[0017] Embodiment 3: The difference between this embodiment and Embodiment 1 is that the PCR reaction system in step 2 is 50 μL consisting of 5 μL 10×PCR buffer, 4 μL dNTP, 1.5 μL forward primer with a concentration of 20 μmol / L, 1.5 μL Concentration of 20μmol / L reverse primer, 0.125U EX Taq DNA polymerase, 1~5ng microbial community DNA and the rest deionized water; 10×PCR buffer contains 2.5mmol / L Mg 2+ ; The concentration of various deoxynucleoside triphosphates in dNTP was 2.5 μmol / L. Other steps and parameters are the same as those in Embodiment 1.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for analyzing microbial community structure and composition using single-strand conformation polymorphism technology, which solves the problem that the existing biological assay and analysis methods are difficult to analyze the composition and structure of microbial community. The method comprises the following steps of: (1) extracting DNA of a microbial community; (2) performing PCR amplification; (3) removing antisense strand with restriction endonuclease; (4) performing gel electrophoresis; (5) purifying DNA; and (6) analyzing the composition and structure of the microbial community. The invention can rapidly and accurately analyze the composition and structure of a complex microbial community in a process system, resolve succession of the community, master the variation of the microbial community in the process system, guide the process, and improve the operating efficiency of the process system.

Description

technical field [0001] The invention relates to a method for analyzing the composition of the microbial community structure. Background technique [0002] Microbial communities have biodiversity and community succession, so it is difficult to analyze the biological composition of microbial communities with existing biological detection and analysis methods. Contents of the invention [0003] The purpose of the present invention is to solve the problem that the existing biological detection and analysis methods are difficult to analyze the biological composition structure of the microbial community, and provide a method for analyzing the composition of the microbial community structure using single-strand conformation polymorphism technology. [0004] The method for analyzing the composition of microbial community structure using single-strand conformation polymorphism technology is carried out as follows: 1. The DNA extraction method (JIZHONG ZHOU, MARY ANNBRUNS, JAMES M.T...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/04C12Q1/68
Inventor王爱杰于振国任南琪阚洪晶刘春爽张运晴赵阳国
OwnerHARBIN INST OF TECH