Psod expression unit
An activity and nucleic acid technology, applied in the field of PSOD expression unit, can solve the problem of enhanced expression of undisplayed genes
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0476] Construction of plasmid pCIS lysC
[0477] In the first step of strain construction, an allelic exchange of the lysC wild-type gene was performed in C. glutamicum ATCC 13032. In this case, a nucleotide exchange was performed in the lysC gene so that the amino acid Thr at position 311 was replaced by Ile in the resulting protein. Starting from chromosomal DNA from ATCC 13032 as a template for PCR reactions, lysC was amplified by means of the Pfu-Turbo PCR system (Stratagene USA) and using oligonucleotide primers SEQ ID NO: 5 and SEQ ID NO: 6 according to the manufacturer's instructions .
[0478] SEQ ID NO: 5
[0479] 5'-GAGAGAGAGACGCGTCCCAGTGGCTGAGACGCATC-3'
[0480] SEQ ID NO: 6
[0481] 5'-CTCTCTCTGTCGACGAATTCAATCTTACGGCCTG-3'
[0482] Chromosomal DNA was prepared from C. glutamicum ATCC 13032 as described in Tauch et al. (1995) Plasmid 33: 168-179 or Eikmanns et al. (1994) Microbiology 140: 1817-1828. At the 5' end of the amplified fragment is a SaII restrictio...
Embodiment 2
[0485] Mutation of lysC gene from Corynebacterium glutamicum
[0486] The lysC gene from Corynebacterium glutamicum was subjected to directed mutagenesis using the Quickchange kit (kit) (from Stratagene / USA) according to the manufacturer's instructions. Mutagenesis was performed in plasmid pCIS lysC (SEQ ID NO: 25). For exchanging from thr 311 to 311ile by the Quickchange method (Stratagene), the following oligonucleotide primers were synthesized:
[0487] SEQ ID NO: 9
[0488] 5'-CGGCACCACCGACATCATCTTCACCTGCCCTCGTTCCG-3'
[0489] SEQ ID NO: 10
[0490] 5'-CGGAACGAGGGCAGGTGAAGATGATGTCGGTGGTGCCG-3'
[0491] The use of these oligonucleotide primers in the Quickchange reaction resulted in an exchange of nucleotides at position 932 (from C to T) in SEQ ID NO: 11 of the lysC gene. After transformation into E. coli XL1-blue and preparation of plasmids, it was confirmed by sequencing reaction that the amino acid exchange Thr311Ile occurred in the lysC gene. The resulting plasmi...
Embodiment 3
[0496] Preparation of integrated plasmid for overexpression of lysC gene by means of heterologous expression unit Psod (SEQ.ID.2)
[0497] The following oligonucleotides were defined for amplifying the promoter of the gene encoding superoxide dismutase.
[0498] SEQ ID 13:
[0499] sod8: 5′-accctggcggaaaccctgagtcg-3′
[0500] SEQ ID 14:
[0501] sod1: 5′-tacgaccagggccacgggtaaaaaatcctttcgtaggtttccgcaccgagcatatacatctt
[0502] ttg-3′
[0503] This primer was used in a PCR reaction with chromosomal DNA from C. glutamicum ATCC 13032. Using this method, a DNA fragment corresponding to the expected size (about 657 bp) can be amplified.
[0504] The following oligonucleotides were defined for the amplification of the gene encoding aspartokinase.
[0505] SEQ ID 15: lysC2: 5'-cctacgaaaggattttttacccgtggccctggtcgtacag-3'
[0506] SEQ ID 16: lysC6: 5'-gattagtggaacctcgtcgtc-3'
[0507] Primers with lysC from Corynebacterium glutamicum ATCC 13032 fbr The chromosomal DNA was used t...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More