Unlock instant, AI-driven research and patent intelligence for your innovation.

Primer and probe sequence for testing pig parvoviral nucleotide fragment

A parvovirus, nucleotide technology, applied in biochemical equipment and methods, DNA/RNA fragments, microbial determination/inspection, etc., can solve the problems of poor specificity, PCR product contamination, low sensitivity, etc.

Inactive Publication Date: 2011-04-06
TAITAI GENOMICS +1
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The current common virus isolation and serological diagnosis methods are cumbersome, time-consuming, low sensitivity, and poor specificity, and are not suitable for early diagnosis of viruses
With the development of molecular biology technology, ordinary PCR method has been widely used in clinical diagnosis, but this technology requires post-processing of PCR products, which can easily lead to contamination of PCR products and a certain degree of non-specific amplification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer and probe sequence for testing pig parvoviral nucleotide fragment
  • Primer and probe sequence for testing pig parvoviral nucleotide fragment
  • Primer and probe sequence for testing pig parvoviral nucleotide fragment

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] 1. Design of primers and probes: Through comparative analysis of all known porcine parvovirus genome sequences, select a segment with no secondary structure and a high degree of conservation, and design multiple pairs of primers and probes. The length of the primers is generally 20 There is no complementary sequence between and within the primers. The optimal primer and probe sequence combinations are as follows:

[0012] Upstream primer PPVpf: CAACTACGCAGCAACTCCAATAC

[0013] Downstream primer PPVpr: GGTTGGTGAAAGTTGGTGTTGTT

[0014] Probe PPVpb: CTCGCTCCACGGCTCCAAGGCTAA

[0015] 2. Establishment and optimization of the reaction system:

[0016] Establishment and optimization of porcine parvovirus real-time fluorescent PCR reaction system:

[0017] The target region template was obtained by the following method: using the inactivated porcine parvovirus strain as the sample to be tested, the viral genomic DNA was extracted by the phenol-chloroform extraction method, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a primer sequence and a probe sequence used for detecting ribonucleotide fragments of porcine parvovirus. The primer sequence comprises a primer pair composed of an upstream primer PPVpf and a downstream primer PPVpr, wherein, the sequence of the upstream primer PPVpf is CAACTACGCAGCAACTCCAATAC, and the sequence of the downstream primer PPVpr is GGTTGGTGAAAGTTGGTGTTGTT. The sequence of a probe PPVpb is CTCGCTCCACGGCTCCAAGGCTAA.

Description

technical field [0001] The invention relates to a primer and a probe sequence for detecting porcine parvovirus nucleotide fragments. Background technique [0002] In recent years, pig diseases have become more and more complicated and serious. Due to the needs of pig breeding and breeding, the circulation and trade volume of breeding pigs has increased greatly. The combined effect of many factors has made pig reproductive disorders more and more serious. The losses caused by this are immeasurable, and have constituted a serious threat to the world's pig industry. Reproductive disorders of pigs mainly include viruses, bacteria, parasites and some micro-bodies, among which viral diseases are the most harmful, such diseases include porcine reproductive and respiratory syndrome (PRRS), porcine parvovirus (PPV) infection, pseudorabies (PR), swine fever (CSF), porcine circovirus (PCV-2) infection, Japanese encephalitis B (JE), etc. These pathogens exist widely in China and can i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
Inventor 贾赟张经纬吴斌胡传伟肖性龙李振荣李叶
Owner TAITAI GENOMICS