Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

T2r taste receptors and genes encoding same

A taste receptor and encoding technology, applied in the field of genes and cDNA, can solve the problems of lack of understanding of molecules and pathways that mediate sensory signal responses

Inactive Publication Date: 2009-04-01
SENOMYX INC
View PDF29 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although much is known about the psychophysics and physiology of taste cell function, there is little understanding of the molecules and pathways that mediate sensory signal responses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • T2r taste receptors and genes encoding same
  • T2r taste receptors and genes encoding same
  • T2r taste receptors and genes encoding same

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0252] Preparation and screening of combinatorial chemical libraries is well known to those skilled in the art. Such combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S. Patent 5,010,175, Furka, Int. J. Pept. Prot. Res., 37:487-493 (1991) and Houghton et al., Nature , 354:84-88 (1991)). Other chemistries for generating chemically diverse libraries can also be used. These chemicals include, but are not limited to: peptoids (eg WO91 / 19735), encoded peptides (eg WO 93 / 20242), random bio-oligomers (PCT eg WO 92 / 00091), benzodiazepines (e.g. U.S. Pat. No. 5,288,514), hydantoins and benzodiazepines And dipeptide heteropolymers (diversomers) (Hubbs et al., PNAS90: 6906-6913 (1993)), ethylene (vinylogous) polypeptides (Hagihara et al., J.Amer.Chem. Soc., 114: 6568 (1992)) , nonpeptidal petidomimetics with a glucose scaffold (Hirschmann et al., J.Amer.Chem.Soc., 114:9217-9218 (1992)), similar organically synthesized small molecule co...

Embodiment

[0267] The following examples summarize the isolated nucleic acid molecules of the present invention, and the corresponding polypeptide sequences to conceptual translations of the nucleic acid molecules. In the protein sequences provided here, the single letter X or Xaa refers to any one of the twenty common amino acid residues. In the DNA sequences provided here, the single letter N or n represents any of the four common nucleotide bases A, T, C, and G.

[0268] hT2R51 full-length cDNA (BAC AC011654) (SEQ ID NO: 1)

[0269] ATGTTGACTCTAACTCGCATCCGCACTGTGTCCTATGAAGTCAGGAGTACATTTCTGTTCA

[0270] TTTCAGTCCTGGAGTTTGCAGTGGGGTTTCTGACCAATGCCTTCGTTTTCTTGGTGAATTTT

[0271] TGGGATGTAGTGAAGAGGCAGGCACTGAGCAACAGTGATTGTGTGCTGCTGTGTCTCAGC

[0272] ATCAGCCGGCTTTTCCTGCATGGACTGCTGTTCCTGAGTGCTATCCAGCTTACCCCACTTCCA

[0273] GAAGTTGAGTGAACCACTGAACCACAGCTACCAAAGCCATCATCATGCTATGGATGATTGCA

[0274] AACCAAGCCAACCTCTGGCTTGCTGCCTGCCTCAGCCTGCTTTACTGCTCCAAGCTCATCC

[0275] GTTTCTCTCACACCTTCCTGATCTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Newly identified mammalian taste-cell-specific G Protein-Coupled Receptors and the genes encoding said receptors are described. Specifically, T2R taste G Protein-Coupled Receptors that are believed to be involved in bitter taste sensation, and the genes encoding the same, are described, along with methods for isolating such genes and for isolating and expressing such receptors. Methods for representing taste perception of a particular tastant in a mammal are also described, as are methods for generating a novel molecules or combinations of molecules that elicit a predetermined taste perception in a mammal, and methods for simulating one or more tastes.

Description

[0001] This application is a divisional application of the application with the same name with the application number 01809145.8 and the application date on April 4, 2001. [0002] Cross References Involving Applications [0003] This application claims priority to U.S. Ser. No. 60 / 195,532, filed April 7, 2000, and U.S. Ser. No. 60 / 247,014, filed November 13, 2000, both of which patents The application is hereby incorporated by reference in its entirety. field of invention [0004] The present invention relates to recently identified mammalian chemosensory G protein-coupled receptors, families of these receptors and genes and cDNAs encoding these receptors. In particular, the present invention relates to recently identified mammalian chemosensory G protein-coupled receptors active in the generation of taste signals, families of these receptors, genes and cDNAs encoding these receptors, and to the analysis and discovery of taste modulators. Methods of use of such receptors, g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12C07K14/705C12N1/21C12N1/19C12N5/10C12N15/63C12N11/08C07K19/00C12Q1/68C12Q1/02G01N33/53
Inventor J·E·阿德勒
Owner SENOMYX INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com