Scaffold proteins derived from epidermal growth factor, lectin and Tat proteins

An epidermal growth factor and scaffold protein technology, applied in the field of protein engineering, can solve the problems of poor stability, low tissue permeability, high production cost, and achieve the effect of high specificity and high affinity

Active Publication Date: 2021-08-27
艾时斌
View PDF10 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, as a macromolecular protein, antibodies have natural limitations, such as super large molecular weight, low tissue permeability, poor stability, high production cost, large dosage and potential immunogenicity, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Scaffold proteins derived from epidermal growth factor, lectin and Tat proteins
  • Scaffold proteins derived from epidermal growth factor, lectin and Tat proteins
  • Scaffold proteins derived from epidermal growth factor, lectin and Tat proteins

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1: Construction of recombinant vector

[0053]First design the 5'-end UTR sequence required for cDNA display: GATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATT ACCAACAACAACAACAAACAACAACAACATTACATTTTACATTCTACAACTA CAAGCCACCATGGAATTC (including T7 promoter, 5'-UTR sequence of tobacco mosaic virus, kozak sequence and compilation initiation codon sequence, etc.), Named T7Ω. Then design the 3'-end UTR sequence required for cDNA display: TTTCCCCGCCGCCCCCCGCCCTTGTCCGCCAAGCTTGTGATGATGATGGTGGTGAGACCCTCCGCCTGAGCCTCCACCATCATTTGTCCAT CCTTCATC (including 6×His-tag, spacer sequence and linker sequence for connecting puromycin, etc.), named tolA_His. There is a 40bp homologous region between T7Ω and tolA_His, which was sent to a gene synthesis company for synthesis. DNA assembly was carried out according to the operation manual of NEBBuilder HiFi DNA Assembly Master Mix Kit (NEB), and equimolar DNA fragments were added respectively, and then DNA assembly mixture (total...

Embodiment 2

[0054] Embodiment 2: Synthesis of puromycin-biotin cross-linked compound

[0055] Take 20nM puromycin segment (PS): (5'-Thiol-Modifier C6)-TC-(fluorescein-dT)-(12-carbon polyethylene glycol) 4 - CC-Puromycin (BEX), added to 4mM tetrachlorophenol and 50mM phosphate buffer (pH 7.0), mixed at room temperature, desalted with NAP-5 desalting column. Another 10 nM biotin fragment (biotinsegment, BS): CCCGGTGCAGCTGTTTCATC-(Biotin-dT)-CG GAAACAGCTGCACCCCCCGCCGCCCCCCG-(Amino-Modifier C6 dT)-CCT(BEX) and 2 μM 6-(maleimido)hexyl Add acid succinimide ester cross-linking agent to 0.2M phosphate buffer (pH 7.0) and mix well, incubate at 37°C for 30min, and remove excess cross-linking agent by ethanol precipitation at 4°C. The precipitate was washed twice with 70% pre-cooled ethanol, dissolved in 0.2M phosphate buffer (pH 7.0), added PS, and stirred overnight at 4°C. Add 5 mM DTT (dithiothreitol), stir at 37°C for 30 min to stop the reaction, remove excess PS by ethanol precipitation, diss...

Embodiment 3

[0056] Embodiment 3: Preparation of protein-streptavidin (SA) magnetic beads labeled with biotin (biotin)

[0057] SA magnetic beads (Invitrogen) were treated with solution A (diethylpyrophosphate-treated water, 0.1M NaOH, 0.05M NaCl) and solution B (diethylpyrophosphate-treated water, 0.1M NaCl), and added to 2× Binding buffer [20mM Tris-HCl pH 8.0, 2mM ethylenediaminetetraacetic acid (EDTA), 2M NaCl, 0.2% Triton X-100], stored at -20°C for use. Take appropriate amount of coronavirus S protein (Spike) S 1 subunits, N-methyl-D-aspartate receptor (NMDAR), vascular endothelial growth factor (VEGF), tumor necrosis factor-α (TNF-α), epidermal growth factor receptor-2 (HER2), and Dissolve proprotein convertase subtilisin 9 (PCSK9) protein in 0.2M phosphate buffer (pH 7.0), add sufficient amount of Sulfo-NHS-biotin (Pierce), put it on ice for 2 hours, and react to generate Spike-biotin and NMDAR -biotin, VEGF-biotin, TNF-α-biotin, HER2-biotin, and PCSK9-biotin compounds, plus SA m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention relates to recombinant scaffold proteins derived from epidermal growth factor, lectin and Tat protein. The recombinant scaffold protein designed by the invention has an amino acid recombinant sequence of a receptor binding domain derived from a human epidermal growth factor, a collagen-like structural domain of human fibrogelling protein, a human mannose binding lectin glycosyl recognition domain and a Tat protein of an HIV-1 virus. The scaffold protein has the capability of displaying the functional protein, and is especially suitable for in-vitro display or library construction in a related system, and the displayed functional protein has the characteristics of glycoprotein binding activity, transmembrane and nuclear translocation activity and high affinity and high specificity with a target. The method can be widely applied and researched in the fields of biology, medicine, environment, agriculture, food and the like. The invention also relates to various uses of the scaffolds, including in therapy, diagnosis, environmental and safety monitoring, synthetic biology and research, and to cells and cell cultures expressing scaffold proteins.

Description

technical field [0001] The invention belongs to the field of protein engineering. More specifically, the present invention relates to recombinant scaffold proteins derived from epidermal growth factor, lectin and Tat proteins. Background technique [0002] For decades, through biotechnology, many affinity functional proteins that can specifically bind to target molecules have been obtained, and are widely used in many fields such as biology, medicine, environment, agriculture, and food. Among these affinity function proteins, antibodies are typical representatives. For a long time, antibodies have been deeply used in clinical disease treatment, diagnosis and basic research, and have become an effective tool for human beings to overcome diseases. However, as a macromolecular protein, antibodies have natural limitations, such as super large molecular weight, low tissue permeability, poor stability, high production cost, high dosage and potential immunogenicity. In order to ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/47C07K14/485C07K14/78C07K14/16A61K38/16A61P3/06A61P3/10A61P9/00A61P31/14A61P35/00A61P37/02
CPCC07K14/485C07K14/78C07K14/4726C07K14/005A61K38/16A61P31/14A61P3/10A61P9/00A61P37/02A61P35/00A61P3/06C12N2740/16022
Inventor 艾时斌杨帆刘鑫韩晓芳陈晶
Owner 艾时斌
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap