Heterozygous antibacterial peptide CA-MA and recombinant expression method thereof
A technology of hybrid antimicrobial peptides and expression methods, applied in the direction of hybrid peptides, recombinant DNA technology, chemical instruments and methods, etc., can solve the problem of reducing the production and activity of antimicrobial peptides, increasing the difficulty of purification of antimicrobial peptides, cutting incomplete antimicrobial peptides, etc. problems, to achieve the effect of stable and reliable purification, conducive to large-scale production, and simple purification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] The construction of embodiment 1 prokaryotic expression plasmid pQEUBI
[0055] Using PUF and PUR as specific primers, the housefly ubiquitin (ubiquitin) was site-directed mutation by PCR technology, so that its C-terminal contained four amino acids (Leu 73 、Arg 74 、Gly 75 、Gly 76 )the sequence of. Housefly ubiquitin has a Sac II restriction site at the C-terminus (Leu 73 、Arg 74 ) and the recognition sequence of housefly ubiquitin C-terminal hydrolase (FUCH) (Gly 75 -Gly 76 ), the fusion protein is conducive to the release of the target protein after being cleaved by the housefly ubiquitin C-terminal hydrolase. BamH I, Sac II (Leu 73 、Arg 74 ) and HindIII restriction sites. Recovered by agarose gel electrophoresis with a mass fraction of 0.8%, then inserted into the prokaryotic expression vector pQE30 ( figure 1 ), the BamH I and HindIII restriction windows of ) were constructed into plasmid pQEUBI. The specific process of plasmid construction is as follows...
Embodiment 2
[0056] Embodiment 2 Construction of recombinant expression plasmid pQEUBICAMA
[0057] (1) Amplification of CA-MA sequence
[0058] (a) Design the cDNA of the recombinant antimicrobial peptide according to the amino acid sequence of Musca domestica cecropihA (1-8) and the amino acid sequence of Xenopus magainin2 (1-12);
[0059] (b) Design primers P1 and P2 according to the codons favored by bacteria,
[0060] P1: 5′-AGC TGGCATGAAATGGAAGATTGGTAAGAAAATCGGCATTGGTAAGTTCTTA-3' (black italics indicate that the introduced restriction site is SacII),
[0061] P2: 5′-GGC TTAGTTGAATTTCTTAGCAGAATGTAAGAACTTACCAATGCCGA-3' (black italics indicate that the introduced enzyme cleavage site is HindIII);
[0062] Synthesized by Shanghai Handsome Biotechnology Co., Ltd., use ddH before use 2 O diluted to 10 μM.
[0063] (c) Amplify the recombinant antimicrobial peptide by conventional chain polymerase reaction.
[0064] Use P1 and P2 as templates and primers, perform PCR with high-fidel...
Embodiment 3
[0076] Embodiment 3 Enzyme digestion identification of recombinant expression plasmid pQEUBICAMA
[0077] Select the positive clones, extract the plasmid pQEUBICAMA, digest with BamHI and HindIII, and detect the product by 1.2% agarose gel electrophoresis. Two DNA bands appear, and the positions are consistent with the prediction (such as Figure 6 shown).
PUM
| Property | Measurement | Unit |
|---|---|---|
| molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 