Unlock instant, AI-driven research and patent intelligence for your innovation.

Heterozygous antibacterial peptide CA-MA and recombinant expression method thereof

A technology of hybrid antimicrobial peptides and expression methods, applied in the direction of hybrid peptides, recombinant DNA technology, chemical instruments and methods, etc., can solve the problem of reducing the production and activity of antimicrobial peptides, increasing the difficulty of purification of antimicrobial peptides, cutting incomplete antimicrobial peptides, etc. problems, to achieve the effect of stable and reliable purification, conducive to large-scale production, and simple purification

Inactive Publication Date: 2012-08-15
SUN YAT SEN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

It was found in the research that most of the fusion proteins exist in the form of inclusion bodies, which increases the difficulty of purification of antimicrobial peptides (Lu Qiang et al., 2002; Wang Laicheng et al., 2005; Li et al., 2006), and the fusion protein is in the form of exogenous protease During cleavage, incomplete cleavage often occurs or excess amino acids at the N-terminal of antimicrobial peptides are increased (Wu et al., 1999; Liang et al., 2006), which reduce the yield and activity of antimicrobial peptides
Moreover, the use of exogenous proteases makes the purification of antimicrobial peptides uneconomical

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Heterozygous antibacterial peptide CA-MA and recombinant expression method thereof
  • Heterozygous antibacterial peptide CA-MA and recombinant expression method thereof
  • Heterozygous antibacterial peptide CA-MA and recombinant expression method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] The construction of embodiment 1 prokaryotic expression plasmid pQEUBI

[0055] Using PUF and PUR as specific primers, the housefly ubiquitin (ubiquitin) was site-directed mutation by PCR technology, so that its C-terminal contained four amino acids (Leu 73 、Arg 74 、Gly 75 、Gly 76 )the sequence of. Housefly ubiquitin has a Sac II restriction site at the C-terminus (Leu 73 、Arg 74 ) and the recognition sequence of housefly ubiquitin C-terminal hydrolase (FUCH) (Gly 75 -Gly 76 ), the fusion protein is conducive to the release of the target protein after being cleaved by the housefly ubiquitin C-terminal hydrolase. BamH I, Sac II (Leu 73 、Arg 74 ) and HindIII restriction sites. Recovered by agarose gel electrophoresis with a mass fraction of 0.8%, then inserted into the prokaryotic expression vector pQE30 ( figure 1 ), the BamH I and HindIII restriction windows of ) were constructed into plasmid pQEUBI. The specific process of plasmid construction is as follows...

Embodiment 2

[0056] Embodiment 2 Construction of recombinant expression plasmid pQEUBICAMA

[0057] (1) Amplification of CA-MA sequence

[0058] (a) Design the cDNA of the recombinant antimicrobial peptide according to the amino acid sequence of Musca domestica cecropihA (1-8) and the amino acid sequence of Xenopus magainin2 (1-12);

[0059] (b) Design primers P1 and P2 according to the codons favored by bacteria,

[0060] P1: 5′-AGC TGGCATGAAATGGAAGATTGGTAAGAAAATCGGCATTGGTAAGTTCTTA-3' (black italics indicate that the introduced restriction site is SacII),

[0061] P2: 5′-GGC TTAGTTGAATTTCTTAGCAGAATGTAAGAACTTACCAATGCCGA-3' (black italics indicate that the introduced enzyme cleavage site is HindIII);

[0062] Synthesized by Shanghai Handsome Biotechnology Co., Ltd., use ddH before use 2 O diluted to 10 μM.

[0063] (c) Amplify the recombinant antimicrobial peptide by conventional chain polymerase reaction.

[0064] Use P1 and P2 as templates and primers, perform PCR with high-fidel...

Embodiment 3

[0076] Embodiment 3 Enzyme digestion identification of recombinant expression plasmid pQEUBICAMA

[0077] Select the positive clones, extract the plasmid pQEUBICAMA, digest with BamHI and HindIII, and detect the product by 1.2% agarose gel electrophoresis. Two DNA bands appear, and the positions are consistent with the prediction (such as Figure 6 shown).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention discloses hybrid antibacterial peptide CA-MA and a recombinant expression method thereof. Ubiquitin from housefly is taken as a fusion chaperone to construct a fusion expression vector pQEUBICAMA which efficiently expresses the hybrid antibacterial peptide CA-MA. The recombinant antibacterial peptide has efficient and broad-spectrum antibacterial activity. After the recombinant antibacterial peptide is fused with the ubiquitin from the housefly, soluble foreign protein is efficiently expressed in Esherichia coli, which providing a molecular platform for the efficient expression of the antibacterial peptide. The hybrid antibacterial peptide has the advantages of high expression level, stable expression and the like. The pQEUBICAMA vector can efficiently express the CA-MA in the form of fusion protein, and an expression product thereof has good solubility, the fusion protein can achieve accurate cutting in the presence of housefly ubiquitin hydrolase, purification is simple, and recombinant protein has natural biological activity, the purification adopted is stable and reliable with high yield, thus being beneficial to mass production and also applicable to research ona relation between functions and conformation of the CA-MA.

Description

technical field [0001] The invention relates to a hybrid antibacterial peptide CA-MA and a recombinant expression method thereof, belonging to the field of biotechnology. Background technique [0002] Antibacterial peptides are a class of small molecule cationic peptides produced by the host to resist external pathogen infection (Milner et al., 1996; Bals et al., 1999), widely present in insects, plants, animals and humans, except In addition to non-specific anti-bacteria, fungi, viruses and other pathogenic effects (Bellm et al., 2000; Hancock et al., 2000), they also have anti-tumor cell effects, so they are also called peptide antibiotics. Antimicrobial peptides have a broad antibacterial spectrum, have killing effects on multidrug-resistant bacteria, tumor cells, and HIV, and may even have anti-severe acute respiratory syndrome (SARS) virus effects. The unique bactericidal mechanism of antimicrobial peptides, This makes it a new type of antibacterial drug with great dev...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00C12N15/70C12N15/74C12R1/19
Inventor 张文庆金丰良许小霞汪延生陈宏鑫王娟
Owner SUN YAT SEN UNIV