Unlock instant, AI-driven research and patent intelligence for your innovation.

Method for fast detecting Saimonella

A detection method, Salmonella technology, applied in biochemical equipment and methods, microbial determination/inspection, resistance to vector-borne diseases, etc.

Inactive Publication Date: 2009-08-05
陈福生 +1
View PDF0 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These methods can amplify the target nucleic acid to a similar order of magnitude, have higher detection limits and are all about one hour, but they still have some defects that cannot be overcome
Some of them require sophisticated instruments to amplify, and some require sophisticated methods to detect the amplified products because of the low specificity of the selection of the target sequence
Despite its simplicity, the need for high-precision thermal cyclers keeps PCR from being a powerful technique that is widely used
On the other hand, NASBA and 3SR that do not use a thermal cycler have greatly reduced specificity, mainly because a relatively low temperature of 40°C must be used for amplification
SDA largely overcomes these shortcomings by using four primers to amplify under isothermal conditions, but there is still a thin link: expensive modified nucleotides must be used as substrates for the amplification reaction

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0035] Implementation steps

[0036] 1. Primer Design

[0037] Outer primer F3 (forward outer primer): TGTTACGGCTATTTTGACCA

[0038] Outer primer B3 (forward outer primer): TCGAGATCGCCAATCAGT

[0039] Inner primer FIP (backward inner primer):

[0040] AGAGTACGCTTAAAACCACCGA-TTTCAATGGGAACTCTGCC

[0041] Internal primer BIP (backward inner primer):

[0042] TAGCGCCGCCAAACCTAAAA-CCTAACGACGACCCTTCT

[0043] 2. Sample handling

[0044] Samples were processed according to GB / T4789.4-2003. After enrichment culture, 1 mL of the culture was taken and centrifuged at 12 000 r / min for 5 min; ), centrifuge at 12 000r / min for 5min, add 100μL of sterile water to the precipitate, mix well, place in a boiling water bath at 100°C for 15min, immediately ice-bath for 5min, and centrifuge at 12000r / min for 5min, and the supernatant is the extracted DNA template.

[0045] 3. LAMP reaction system

[0046] Add the following substances to the 25 μL reaction system:

[0047]10×LAMP buffer 2.5μ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the quick detection technology of food-borne pathogenic bacteria, and in particular relates to a detection method of loop-mediated isothermal amplification (LAMP) for salmonella. The detection method comprises the preparation of a reagent comprising a sample processing reagent, an LAMP reaction reagent, a large segment of BstDNA polymerase, agarose, bromophenol blue sampling buffer solution and ethidium bromide solution and the detection procedures of the detection an amplified product and the generation of deposition. The detection method comprises the following steps: firstly designing a specific primer; secondly extracting DNA from a sample; thirdly, establishing a reaction system. Compared with the traditional bacterial culture method, the immunity detection method and other molecular biology method adopted presently, the method has the advantages of simple operation, quickness, no special instrument reagent and specific sensitivity. The invention can be applied to the quick detection of the salmonella in foods and other samples.

Description

technical field [0001] The invention relates to the application of species-specific primers in the detection of Salmonella by loop-mediated isothermal DNA amplification reaction. These primers can be used to detect Salmonella contamination in food. Background technique [0002] Salmonella (Salmonella spp.) is a kind of Gram-negative intestinal pathogenic bacteria that is widely distributed in nature and can cause human and animals to become ill. It can cause human gastroenteritis, typhoid fever, sepsis and other symptoms . At present, more than 2,000 serotypes have been isolated in the world, and 216 serotypes have been found in my country. According to the statistics of the National Foodborne Disease Surveillance Network, microorganisms contaminated in food are one of the main factors causing foodborne diseases. In the past ten years, Salmonella has always been the most common and main pathogenic factor in foodborne diseases caused by microorganisms in my country, especi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/04
CPCY02A50/30
Inventor 陈福生朱胜梅
Owner 陈福生