Method for fast detecting Saimonella
A detection method, Salmonella technology, applied in biochemical equipment and methods, microbial determination/inspection, resistance to vector-borne diseases, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment Construction
[0035] Implementation steps
[0036] 1. Primer Design
[0037] Outer primer F3 (forward outer primer): TGTTACGGCTATTTTGACCA
[0038] Outer primer B3 (forward outer primer): TCGAGATCGCCAATCAGT
[0039] Inner primer FIP (backward inner primer):
[0040] AGAGTACGCTTAAAACCACCGA-TTTCAATGGGAACTCTGCC
[0041] Internal primer BIP (backward inner primer):
[0042] TAGCGCCGCCAAACCTAAAA-CCTAACGACGACCCTTCT
[0043] 2. Sample handling
[0044] Samples were processed according to GB / T4789.4-2003. After enrichment culture, 1 mL of the culture was taken and centrifuged at 12 000 r / min for 5 min; ), centrifuge at 12 000r / min for 5min, add 100μL of sterile water to the precipitate, mix well, place in a boiling water bath at 100°C for 15min, immediately ice-bath for 5min, and centrifuge at 12000r / min for 5min, and the supernatant is the extracted DNA template.
[0045] 3. LAMP reaction system
[0046] Add the following substances to the 25 μL reaction system:
[0047]10×LAMP buffer 2.5μ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap