Method for predicting drug tolerance of endocrine medicament in estrogen receptor antagonists
A technology of estrogen receptors and prediction methods, which is applied in the determination/testing of microorganisms, biochemical equipment and methods, material stimulation analysis, etc., can solve the problem that antibodies cannot effectively distinguish ERα and ERβ, and reduce drug resistance reactions and side effects, accurate detection, and guaranteed specific effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0035] The present invention is described in detail below, which is an explanation of the present invention rather than a limitation.
[0036] In the present invention, long-term follow-up patients who are positive for ER in clinical breast cancer tissues and take estrogen receptor antagonist drugs are taken as detection objects, and a kind of estrogen receptor antagonist class endocrine drugs (estrogen derivatives, steroid compound or non-steroidal complexes) drug resistance prediction method, using real-time quantitative PCR to detect the relative expression levels of ERα and ERβ mRNA in breast cancer, in order to predict the resistance of estrogen receptor antagonist endocrine drugs, Specifically include the following steps:
[0037] 1) Design and synthesize the PCR amplification primer pair P1 of ERα and the PCR amplification primer pair P2 of ERβ:
[0038]Primer pair P1 is:
[0039] Upstream primer: gcagggagaggagtttgtgt20;
[0040] Downstream primer: atgtggggaga ggatga...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com