Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for predicting drug tolerance of endocrine medicament in estrogen receptor antagonists

A technology of estrogen receptors and prediction methods, which is applied in the determination/testing of microorganisms, biochemical equipment and methods, material stimulation analysis, etc., can solve the problem that antibodies cannot effectively distinguish ERα and ERβ, and reduce drug resistance reactions and side effects, accurate detection, and guaranteed specific effects

Inactive Publication Date: 2010-03-03
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, when clinical laboratories use immunohistochemical methods to detect ER expression levels in breast cancer, most of the antibodies used only target ERα or cannot effectively distinguish ERα and ERβ
Clinical breast cancer tissue biopsy only considers whether to use tamoxifen-like estrogen receptor antagonists based on the expression of ERα, while ignoring the detection of ERβ, resulting in drug resistance and side effects such as endometrial cancer in some patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for predicting drug tolerance of endocrine medicament in estrogen receptor antagonists
  • Method for predicting drug tolerance of endocrine medicament in estrogen receptor antagonists
  • Method for predicting drug tolerance of endocrine medicament in estrogen receptor antagonists

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0035] The present invention is described in detail below, which is an explanation of the present invention rather than a limitation.

[0036] In the present invention, long-term follow-up patients who are positive for ER in clinical breast cancer tissues and take estrogen receptor antagonist drugs are taken as detection objects, and a kind of estrogen receptor antagonist class endocrine drugs (estrogen derivatives, steroid compound or non-steroidal complexes) drug resistance prediction method, using real-time quantitative PCR to detect the relative expression levels of ERα and ERβ mRNA in breast cancer, in order to predict the resistance of estrogen receptor antagonist endocrine drugs, Specifically include the following steps:

[0037] 1) Design and synthesize the PCR amplification primer pair P1 of ERα and the PCR amplification primer pair P2 of ERβ:

[0038]Primer pair P1 is:

[0039] Upstream primer: gcagggagaggagtttgtgt20;

[0040] Downstream primer: atgtggggaga ggatga...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for predicting the drug tolerance of an endocrine medicament in estrogen receptor antagonists, which adopts a real-time quantitative method to detect the relative express level of ER alpha and ER beta in breast cancer so as to predict the drug tolerance of the endocrine medicament in the estrogen receptor antagonists. The method comprises the following steps: comparing the relative express level of ER alpha and ER beta genes of a target to be detected with that of a normal contrast, and analyzing the drug tolerance of the endocrine medicament in the estrogen receptor antagonists, wherein the drug tolerance of the endocrine medicament in the estrogen receptor antagonists is negative when the ratio of ER alpha / ER beta of the target to be detected is more than that of the normal contrast; and the drug tolerance of the endocrine medicament in the estrogen receptor antagonists is positive when the ratio of ER alpha / ER beta of the target to be detected is less than that of the normal contrast. The method for predicting the drug tolerance provides a feasible basis for directing the medication of the breast caner individuals in clinic, and can reduce thedrug tolerance reaction and side effect caused by blind use of drugs.

Description

technical field [0001] The invention belongs to the field of physiological and biochemical detection, and relates to a method for predicting drug resistance of estrogen receptor antagonist endocrine drugs based on detecting the relative expression levels of ERα and ERβ in breast cancer. Background technique [0002] Breast cancer is a hormone-induced tumor. About 1.2 million women around the world develop breast cancer every year, and 500,000 women die from breast cancer. In developed countries such as Western Europe and North America, the incidence of breast cancer ranks first among female malignant tumors; The incidence of breast cancer in my country has been rising continuously in recent years, and there is a trend of rejuvenation. According to the hormone-induced characteristics of breast cancer, patients have been treated with endocrine therapy for more than 100 years. Currently, estrogen receptor (ER) is used as a therapeutic target, and estrogen receptor antagonists a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68G01N21/64
Inventor 李燕李绍青药立波刘新平
Owner FOURTH MILITARY MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More