Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for distinguishing conventional cotton and hybrid cotton in assistant mode and special kit thereof

A kit and hybrid cotton technology, applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve the problems of inconspicuous, difficult to distinguish, and difficult to distinguish the F2 generation of hybrid materials.

Active Publication Date: 2010-04-21
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF0 Cites 18 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

With the promotion of transgenic insect-resistant cotton varieties, the genetic basis between varieties is relatively narrower, and the parents of hybrid cotton are closer. Due to the higher degree of similarity in genetic background, the separation of F2 generations of some hybrid materials is not obvious, and it is difficult to distinguish
At present, it is not easy to distinguish between conventional cotton and hybrid cotton, F1 generation and F2 generation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for distinguishing conventional cotton and hybrid cotton in assistant mode and special kit thereof
  • Method for distinguishing conventional cotton and hybrid cotton in assistant mode and special kit thereof
  • Method for distinguishing conventional cotton and hybrid cotton in assistant mode and special kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0114] Embodiment 1, the composition of kit and the composition of SSR atlas

[0115] 1. The kit for assisting in identifying conventional cotton and hybrid cotton or assisting in identifying F1 generation cotton seeds and F2 generation cotton seeds consists of the following 16 pairs of primers:

[0116] Table 1, 16 pairs of primer sequences

[0117] serial number

Primer name

forward primer sequence

reverse primer sequence

1

DPL0431

CTATCACCCTTCTCTAGTTGCGTT (sequence 1)

ATCGGGCTCACAAACATCA (sequence 2)

2

NAU1042

CATGCAAATCCATGCTAGAG

GGTTTCTTTGGTGGTGAAAC

3

NAU1071

ACCAACAATGGTGACCTCTT

CCCTCCATAACCAAAAGTTG

4

NAU1085

AGTCGCCCCTTCTCTAATTT

TGTAAACCGAACTCGTTGTG

5

NAU1102

ATCTCTCTGTCTCCCCCCTTC

GCATATCTGGCGGGTATAAT

6

NAU1103

GGAGCCAGAAGTTGAGAAAA

TTCGGCTTCTGCTTTTACTT

[0118] serial number

Primer name

forward primer seq...

Embodiment 2

[0174] Embodiment 2, distinguish conventional cotton and hybrid cotton with kit and SSR collection of illustrative plates in embodiment 1

[0175] 1. The identification method is as follows:

[0176] 1) Take a cotton variety to be identified, randomly take 10 seeds for indoor germination, and obtain 10 cottons to be identified;

[0177] 2) Genomic DNA of 10 cotton cotyledons to be identified were extracted respectively;

[0178] 3) using the genomic DNA of each cotton plant as a template, carrying out PCR amplification with 16 pairs of primers respectively, and obtaining PCR amplification products corresponding to 16 pairs of primers for each cotton plant;

[0179] 4) carry out polyacrylamide gel electrophoresis to the PCR amplification products (ie all PCR amplification products) corresponding to 16 pairs of primers of each cotton plant;

[0180] 5) detect the collection of illustrative plates of the PCR amplification product of each pair of primers corresponding to each co...

Embodiment 3

[0196] Embodiment 3, use kit and SSR collection of illustrative plates to identify F1 generation cotton seeds and F2 generation cotton seeds in embodiment 1

[0197] 1) 24 seeds are randomly selected from the cotton seeds to be identified as the detection seeds;

[0198] 2) 24 test seeds were germinated indoors to obtain 24 cotton plants, and the genomic DNA of the cotyledons of the 24 cotton plants were extracted respectively;

[0199] 3) with the partial primers in Example 1, the genomic DNA of each strain of cotton is carried out to PCR amplification, obtains the PCR amplification product of each detection seed;

[0200] 4) Carry out polyacrylamide gel electrophoresis to the PCR amplification product of each detection seed, to detect the collection of pictures of the PCR amplification product of each detection seed;

[0201]If each described primer pair is corresponding to the collection of PCR amplification products of each detection seed as follows: it is consistent with...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for distinguishing conventional cotton and hybrid cotton in an assistant mode and a special kit thereof. The method for distinguishing the conventional cotton and the hybrid cotton in the assistant mode comprises the following steps of (1) extracting a genomic DNA of cotton to be distinguished; (2) respectively carrying out PCR amplification on each pair of primers in the kit by using the genomic DNA of the cotton to be distinguished as a template to obtain the spectrums of PCR amplification products of each pair of the primers; and (3) detecting spectrums of the PCR amplification products of each pair of the primers. Proved by experiments, the kit, an SSR spectrum and the distinguishing method can effectively, accurately and quickly distinguish the cotton to be tested to be the conventional cotton or the hybrid cotton and a cotton seed to be tested to be an F1 generation or an F2 generation, thus the kit, the SSR spectrum and the distinguishing method have wide application prospect.

Description

technical field [0001] The invention relates to a method for assisting identification of conventional cotton and hybrid cotton and a special kit thereof. Background technique [0002] In cotton variety approval, cotton regional test is very important. The main purpose of cotton regional test is to identify the high yield, disease resistance, fiber quality, adaptability and stability of cotton varieties in different regions, and provide a basis for the approval and promotion of cotton varieties. scientific basis. The cotton varieties currently participating in the test are divided into conventional cotton and hybrid cotton. Conventional cotton refers to the cotton variety that adopts conventional breeding methods such as systematic breeding, cross breeding, mutation breeding, etc., and undergoes multiple generations of selfing to make the genotype homozygous. Compared with conventional cotton, hybrid cotton is the use of heterosis in cotton. It is a cotton variety whose gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor 付小琼杨付新王秀玲汤磊鹏郭峰光
Owner INST OF COTTON RES CHINESE ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More