Recombinant blue-green algae

A cyanobacteria and sequence technology, applied in recombinant DNA technology, unicellular algae, enzymes and other directions, can solve the problems of unsolved development of bio-energy and food, high cost of raw materials, unfavorable operation and other problems

Inactive Publication Date: 2010-06-23
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this method solves the problem that acetone and the strict anaerobic conditions of butanol-producing Clostridium mixed with acetone and butanol-producing Clostridium in the product are not conducive to operation when the clostridium fermented to produce butanol, Escherichia coli is still a heterotrophic bacterium, and its raw material cost is still very high. The conflict between the development of bioenergy and food issues has not been resolved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant blue-green algae
  • Recombinant blue-green algae
  • Recombinant blue-green algae

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0104] Embodiment 1, the recombination construction of the freshwater cyanobacteria Synechocystis of Chromococcus family Synechocystis

[0105] The starting cyanobacteria used in this example is the freshwater cyanobacterium Synechocystis sp. PCC6803.

[0106] 1. Introduction of genes related to butanol synthesis into the starting bacteria

[0107] The genes related to butanol synthesis in this experiment are composed of crt gene, bcd gene, etfB gene, etfA gene and hbd gene, forming a crt operon, and each gene is from Clostridium.

[0108] 1. Amplification of the crt operon:

[0109] Extract Clostridium acetobutylicum genomic DNA;

[0110] Primers were designed according to the DNA sequence of the crt operon in the Clostridium acetobutylicum genome and the restriction site on the cyanobacteria expression vector pAM2770 as follows:

[0111] crtF: ATTC GAGCTC AATGGAACTAAACAATGTCATCCT (the underlined part is the SacI restriction site);

[0112] crtR:CG GGATCC ATGGGGATTC...

Embodiment 2

[0160] Example 2. Recombination construction of seawater cyanobacterium Synechococcus 7002 of the genus Synechococcus of Chromococcus family

[0161] The starting cyanobacteria used in this example is seawater cyanobacterium Synechococcus sp. PCC7002 (Synechococcus sp. PCC7002).

[0162] 1. Introduction of genes related to butanol synthesis into the starting bacteria

[0163] The sequence and introduction method of the introduced gene are consistent with those described in Example 1.

[0164] The recombinant cyanobacteria transformed into empty vector pAM2770 was named PCC 7002 / pAM2770.

[0165] 2. Replacement of the PHB synthase gene in the cyanobacterium Synechocystis sp.PCC 6803 with the adhe gene in the butanol synthesis pathway of Clostridium

[0166] Methods are consistent with those described in Example 1.

[0167] The cyanobacteria that introduced both the empty vector pAM2770 and the empty vector pUC18 was named PCC7002 / pAM2770 / pUC as a control; the cyanobacteria t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant blue-green algae, which is prepared by a method comprising the step of introducing genes related to butanol synthesis shown in (1) and (2) into yhe chroococcaceae blue-green algae, wherein (1) the genes related to butanol synthesis comprise encoding genes of the following enzymes: electron transfer flavoprotein A subunit, enoyl hydrase, butyryl-COA dehydrogenase and alcohol dehydrogenase; and (2) the genes related to butanol synthesis comprise encoding genes of the following enzymes: electron transfer flavoprotein B subunit, the enoyl hydrase, the butyryl-COA dehydrogenase and the alcohol dehydrogenase. The invention realizes the blue-green algae to transform inexhaustible solar energy and greenhouse gas carbon dioxide on the earth into the energy product butanol, avoids wasting grains and other organic matters in the energy regeneration process, and at the same time is beneficial for environment protection. Therefore, one of ideal methods for realizing the sustained and healthy development of clean and renewable energy sources is to utilize the recombinant blue-green algae of the invention to produce the butanol.

Description

technical field [0001] The invention relates to a recombinant cyanobacterium. Background technique [0002] The energy and environmental issues facing the world require people to develop renewable and clean energy, and the problem of food shortage requires that the development of renewable and clean energy should not compete with others for food, crops, and people. Crops compete for fresh water. [0003] Butanol is an important chemical raw material, mainly used in the manufacture of plasticizers, solvents, extractants, etc. It is a high value-added chemical with a global annual demand of more than 1.4 million tons. In addition, butanol is a new type of biofuel with great potential. It has the following advantages: its calorific value and octane number are equivalent to those of gasoline, and its oxygen content is similar to that of methyl tert-butyl ether commonly used in gasoline; it does not corrode pipelines , convenient for pipeline transportation; its vapor pressure ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/13C12N15/31C12N15/52C12N15/53C12N15/54C12N9/00C12N9/04C12N9/10C07K14/195C12R1/89
Inventor周杰解鹃高成华张延平李寅
OwnerINST OF MICROBIOLOGY - CHINESE ACAD OF SCI