Al technical title is built by PatSnap Al team. It summarizes the technical point description of the patent document.
A cyanobacteria and sequence technology, applied in recombinant DNA technology, unicellular algae, enzymes and other directions, can solve the problems of unsolved development of bio-energy and food, high cost of raw materials, unfavorable operation and other problems
Inactive Publication Date: 2010-06-23
INST OF MICROBIOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 14 Cited by
Summary
Abstract
Description
Claims
Application Information
AI Technical Summary
This helps you quickly interpret patents by identifying the three key elements:
Problems solved by technology
Method used
Benefits of technology
Problems solved by technology
Although this method solves the problem that acetone and the strict anaerobic conditions of butanol-producing Clostridium mixed with acetone and butanol-producing Clostridium in the product are not conducive to operation when the clostridium fermented to produce butanol, Escherichia coli is still a heterotrophic bacterium, and its raw material cost is still very high. The conflict between the development of bioenergy and food issues has not been resolved
Method used
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more
Image
Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
Click on the blue label to locate the original text in one second.
Reading with bidirectional positioning of images and text.
Smart Image
Examples
Experimental program
Comparison scheme
Effect test
Embodiment 1
[0104] Embodiment 1, the recombination construction of the freshwater cyanobacteria Synechocystis of Chromococcus family Synechocystis
[0105] The starting cyanobacteria used in this example is the freshwater cyanobacterium Synechocystis sp. PCC6803.
[0106] 1. Introduction of genes related to butanol synthesis into the starting bacteria
[0107] The genes related to butanol synthesis in this experiment are composed of crt gene, bcd gene, etfB gene, etfA gene and hbd gene, forming a crt operon, and each gene is from Clostridium.
[0110] Primers were designed according to the DNA sequence of the crt operon in the Clostridium acetobutylicum genome and the restriction site on the cyanobacteria expression vector pAM2770 as follows:
[0111] crtF: ATTC GAGCTC AATGGAACTAAACAATGTCATCCT (the underlined part is the SacI restriction site);
[0112] crtR:CG GGATCC ATGGGGATTC...
Embodiment 2
[0160] Example 2. Recombination construction of seawater cyanobacterium Synechococcus 7002 of the genus Synechococcus of Chromococcus family
[0161] The starting cyanobacteria used in this example is seawater cyanobacterium Synechococcus sp. PCC7002 (Synechococcus sp. PCC7002).
[0162] 1. Introduction of genes related to butanol synthesis into the starting bacteria
[0163] The sequence and introduction method of the introduced gene are consistent with those described in Example 1.
[0164] The recombinant cyanobacteria transformed into empty vector pAM2770 was named PCC 7002 / pAM2770.
[0165] 2. Replacement of the PHB synthase gene in the cyanobacterium Synechocystis sp.PCC 6803 with the adhe gene in the butanol synthesis pathway of Clostridium
[0166] Methods are consistent with those described in Example 1.
[0167] The cyanobacteria that introduced both the empty vector pAM2770 and the empty vector pUC18 was named PCC7002 / pAM2770 / pUC as a control; the cyanobacteria t...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
PUM
Login to view more
Abstract
The invention discloses a recombinant blue-green algae, which is prepared by a method comprising the step of introducing genes related to butanol synthesis shown in (1) and (2) into yhe chroococcaceae blue-green algae, wherein (1) the genes related to butanol synthesis comprise encoding genes of the following enzymes: electron transfer flavoprotein A subunit, enoyl hydrase, butyryl-COA dehydrogenase and alcohol dehydrogenase; and (2) the genes related to butanol synthesis comprise encoding genes of the following enzymes: electron transfer flavoprotein B subunit, the enoyl hydrase, the butyryl-COA dehydrogenase and the alcohol dehydrogenase. The invention realizes the blue-green algae to transform inexhaustible solar energy and greenhouse gas carbon dioxide on the earth into the energy product butanol, avoids wasting grains and other organic matters in the energy regeneration process, and at the same time is beneficial for environment protection. Therefore, one of ideal methods for realizing the sustained and healthy development of clean and renewable energy sources is to utilize the recombinant blue-green algae of the invention to produce the butanol.
Description
technical field [0001] The invention relates to a recombinant cyanobacterium. Background technique [0002] The energy and environmental issues facing the world require people to develop renewable and clean energy, and the problem of food shortage requires that the development of renewable and clean energy should not compete with others for food, crops, and people. Crops compete for fresh water. [0003] Butanol is an important chemical raw material, mainly used in the manufacture of plasticizers, solvents, extractants, etc. It is a high value-added chemical with a global annual demand of more than 1.4 million tons. In addition, butanol is a new type of biofuel with great potential. It has the following advantages: its calorific value and octane number are equivalent to those of gasoline, and its oxygen content is similar to that of methyl tert-butyl ether commonly used in gasoline; it does not corrode pipelines , convenient for pipeline transportation; its vapor pressure ...
Claims
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more
Application Information
Patent Timeline
Application Date:The date an application was filed.
Publication Date:The date a patent or application was officially published.
First Publication Date:The earliest publication date of a patent with the same application number.
Issue Date:Publication date of the patent grant document.
PCT Entry Date:The Entry date of PCT National Phase.
Estimated Expiry Date:The statutory expiry date of a patent right according to the Patent Law, and it is the longest term of protection that the patent right can achieve without the termination of the patent right due to other reasons(Term extension factor has been taken into account ).
Invalid Date:Actual expiry date is based on effective date or publication date of legal transaction data of invalid patent.
Login to view more 
Login to view more