Mimic short peptide 7B of endothelial cell growth factor VEGF antigen epitope and application thereof
A growth factor, endothelial cell technology, applied in the field of molecular biology, can solve the problems of high artificial synthesis cost and no obvious homology
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] (1) By bioinformatics methods, the nucleotide sequence of the simulated short peptide 7B obtained by simulating the endothelial cell growth factor VEGF epitope is as follows:
[0024] TTCAAACCGTCCTGCGTTCCGCTGATGCGTTGCGGTGGTTGTGCAACG;
[0025] (2) In order to efficiently construct the short analog peptide 7B with only 48 bases on the phage vector pCANTAB5-E, firstly design primer 1 and primer 2 according to the base sequence and restriction site on pCANTAB5-E for the second step One round of PCR, the two PCR products were used as templates for the second round of PCR. Then, according to the base sequence of the simulated short peptide 7B and the base sequence of the product obtained by the first round of PCR, primer A and primer B were designed, and the second round of PCR was carried out. The amplified product with a base length of 100-200 bp and containing the simulated short peptide 7B was used for the next experiment.
[0026] Primer 1: AAGCTTTGGAGCCTTTTTTTTGGAGATT...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap