MLCR probe, two-step reaction mode and suspension chip detection capture probe

A probe and reaction technology, applied in the field of MLCR probe, two-step reaction mode and capture probe for suspension chip detection, can solve the problem of low detection sensitivity and achieve the effect of improving specificity

Inactive Publication Date: 2010-10-20
SHENZHEN AUDAQUE DATA TECH
View PDF5 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Another technical problem to be solved by the present invention is to make up for the low detection sensitivity of the above-mentioned prior art, and propose a two-step reaction mode of MLCR-PCR for re-amplification of the ligation product transformed by the above-mentioned probe

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • MLCR probe, two-step reaction mode and suspension chip detection capture probe
  • MLCR probe, two-step reaction mode and suspension chip detection capture probe
  • MLCR probe, two-step reaction mode and suspension chip detection capture probe

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment approach 1

[0078] Specific implementation mode 1: Triple gene detection

[0079] In order to visually test the reliability of MLCR-PCR detection technology, gel electrophoresis separation method was used to visually analyze MLCR-PCR reaction products. For this reason, the following three-site probes were synthesized by chemical method, and triple gene detection was performed first.

[0080] 1. Synthetic oligonucleotide sequence:

[0081] MLCR probe sequence

[0082]

[0083] Primers for PCR reactions

[0084] Primer-F: GGGTTCCCTAAGGGTTGGA;

[0085] Primer-R: GCGCCAGCAAGATCCAATCTAGA.

[0086] 2. MLCR reaction

[0087] MLCR reaction system:

[0088] Sample genomic template DNA: 1μl (20ng / μl)

[0089] Mixed probes: 2 μl (10 fmol / μl per probe)

[0090] 10x buffer: 1 μl

[0091] Ampligase: 0.2 Unites

[0092] wxya 2 O: 5.9 μl

[0093]

[0094] Total reaction volume: 10 μl

[0095] MLCR reaction conditions:

[0096] 2 cycles: 94°C, 1....

specific Embodiment approach 2

[0118] Specific implementation mode two: Seven-fold gene detection

[0119] 1. Synthetic Oligonucleotide Sequence

[0120] LCR probe sequence

[0121]

[0122]

[0123]

[0124] Primers for PCR reactions

[0125] Primer-F: GGGTTCCCTAAGGGTTGGA;

[0126] Primer-R: Bio-GCGCCAGCAAGATCCAATCTAGA (5'biotinylated).

[0127] Bio-Plex Capture Probes

[0128] capture probe name

Sequence (5'-3')

base number

modify

CapNOS

cttgtccaagatctattcaggtgcac

26bp

5' end linking 5' amino repair

Decorated C12 arm

Cap35S

cagtggtcccaaagatggacccccac

26bp

5' end linking 5' amino repair

Decorated C12 arm

CapLec

aagttacaactcaataaggttgacg

25bp

5' end linking 5' amino repair

Decorated C12 arm

Cap RRS

ctccgcacaggtgaagtccgccgtgc

26bp

5' end linking 5' amino repair

Decorated C12 arm

CapGos

cagtgtggttggtttcttcggacgc

25bp

5'...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an MLCR probe, a two-step reaction mode and a suspension chip detection capture probe. The MLCR probe is one group of four single-chain DNA probes synthesized aiming at each point to be tested, the tail end of the MLCR probe is connected with a general sequence and used for converting LCR into MLCR; in the two-step reaction mode, the MLCR probe firstly carries out MLCR reaction to be converted into a connecting product, general sequences at the tail end of the connecting product are respectively matched with a general primer, and then PCR reaction for equally amplifying the connecting product is carried out; and the capture probe spans incision recognized by a heat-resisting lignase in the point to be tested, and can be hybridized with a product obtained by the second step PRC amplification at a chip inspection temperature. The invention overcomes the defects of low detection sensitivity of LCR and MLPA and difficult amplification of multiple PCRs by combining with the advantages of the LCR and the MLPA, has the characteristics of high flux, super sensitivity and high specificity, and is suitable for gene testing and Single nucleotide polymorphism analysis of various samples, especially traces and degraded DNA samples.

Description

technical field [0001] The invention relates to gene detection, in particular to a MLCR probe, a two-step reaction mode and a capture probe for suspension chip detection. Background technique [0002] Existing genetic testing methods are generally based on the detection of DNA. Techniques for direct detection of DNA, such as Southern hybridization, fluorescent nanometers, and chemiluminescence, can only detect 1-100 fmol / L levels, and the detection sensitivity is low. Ordinary polymerase chain reaction (polymerase chain reaction, abbreviated as PCR) has high detection sensitivity, strong specificity and low cost. The real-time fluorescent PCR method adds a fluorescent probe on the basis of conventional PCR, which can use the accumulation of fluorescent signals to monitor the entire PCR process in real time, without the need for electrophoresis and other PCR post-processing steps. core position. However, each tube of ordinary, nested and real-time fluorescent PCR detection...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor凌杏园陈枝楠向才玉章桂明康林仲健忠陈洪俊黄新
OwnerSHENZHEN AUDAQUE DATA TECH