Recurrence predicting reagent kit for liver cancer liver transplantation postoperation

A liver transplantation and kit technology, applied in the field of liver cancer recurrence prediction kits after liver transplantation, can solve the problems of unfavorable clinical application, inability to continuously detect, follow-up and tracking, etc., achieve less trauma, prolong overall survival time, and convenient acquisition Effect

Inactive Publication Date: 2010-11-10
ZHONGSHAN HOSPITAL FUDAN UNIV
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these studies mostly use tumor tissue as research materials, and histological tumor markers have many limitations such as specimen collection, inability to continuously detect and follow-up, which are not conducive to actual clinical application.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recurrence predicting reagent kit for liver cancer liver transplantation postoperation
  • Recurrence predicting reagent kit for liver cancer liver transplantation postoperation
  • Recurrence predicting reagent kit for liver cancer liver transplantation postoperation

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0045] A liver cancer recurrence prediction kit after liver transplantation, using two SNPs rs894151 and rs12438080 in plasma circulating DNA as detection sites, including PCR amplification primers and fluorescent detection probes for genotyping;

[0046] Wherein, the PCR amplification primers are:

[0047] rs894151 site:

[0048] Upstream sequence 5'AGAAACACTGAGTCTGCAGG3';

[0049] Downstream sequence 5'GCCTCTTTCCTTCATCTGTC3';

[0050] rs12438080 site:

[0051] Upstream sequence 5'GATGACTCATAGCTTCCCTG3';

[0052] Downstream sequence 5'CTTGCCGAGAGTTTAACAGG3';

[0053] The fluorescent detection probes used for genotyping are:

[0054] rs894151-TA:AACTGTGAATAATAAATGCCACGCA;

[0055] rs894151-TG:TTTAACTGTGAATAATAAATGCCACGCG;

[0056] rs894151-TR:-P-CAAAGCTTTTCACTGTGTTAAGTAA-FAM-;

[0057] rs12438080-TA:TTTTGCTCTCATCAAAAGCAGTTATCACAA;

[0058] rs12438080-TC: TTTTTTTGCTCTCATCAAAGCAGTTATCACAC;

[0059] rs12438080-TR: -P-CAGTAAGTATGGTAAAAATAAAAATAAT-FAM-.

[0060] The spec...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to view more

Abstract

The invention provides a recurrence predicting reagent kit for liver cancer liver transplantation postoperation, which is characterized in that the reagent kit uses two SNPrs rs894151 and rs12438080 in a plasma circulation DNA as detection sites, uses upstream sequences and downstream sequences of the rs894151 and the rs12438080 as amplimers, and uses fluorescent probes as genotyping probes. The invention can evaluate the recurrence risk of the liver transplantation operation carried out by liver cancer patients before the operation, and in addition, the invention uses peripheral blood as detection samples, and has the characteristics of high speed, accuracy, convenience, simplicity, easy popularization and application and the like. The invention can be used for sieving the clinical liver cancer liver transplantation patients, can guide the auxiliary treatment after the liver cancer liver transplantation operation, and can reduce the postoperation recurrence rate of high-risk patients, so the prognosis of the liver cancer liver transplantation is improved, and the limited donor livers can be effectively utilized. The reagent kit has important clinical significance to the prognosis judgment on patients exceeding the Milan standard.

Description

technical field [0001] The invention relates to a kit for predicting recurrence after liver transplantation of liver cancer, which belongs to the field of biotechnology. Background technique [0002] Primary hepatocellular carcinoma (hereinafter referred to as liver cancer) is one of the most common malignant tumors in the world. Due to the high infection rate of hepatitis B virus (HBV) in my country, the incidence of liver cancer remains high. Liver transplantation can completely remove the tumor and restore liver function, and has become one of the radical treatments for liver cancer. However, tumor recurrence and metastasis after transplantation is still the most important factor affecting the curative effect of liver transplantation. Accurate prediction of tumor recurrence and metastasis after transplantation will help to carry out active individualized prevention and treatment measures. At the same time, due to the shortage of donor livers, accurate prediction of prog...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 周俭樊嘉胡捷王征代智肖永胜
Owner ZHONGSHAN HOSPITAL FUDAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap