Unlock instant, AI-driven research and patent intelligence for your innovation.

Molecular marker tightly linked with wheat yellow mosaic resistant major quantitative trait locus (QTL) and application thereof

A molecular marker and wheat technology, which is applied in the fields of wheat breeding and molecular biology, can solve the problems that there are no reports on molecular markers of the main QTL for resistance to wheat yellow mosaic disease, and achieve the goal of improving breeding efficiency, high accuracy, and reducing workload Effect

Inactive Publication Date: 2011-11-16
JIANGSU ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] So far, there is no report of molecular markers linked to CI12633 major QTL for resistance to wheat yellow mosaic disease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker tightly linked with wheat yellow mosaic resistant major quantitative trait locus (QTL) and application thereof
  • Molecular marker tightly linked with wheat yellow mosaic resistant major quantitative trait locus (QTL) and application thereof
  • Molecular marker tightly linked with wheat yellow mosaic resistant major quantitative trait locus (QTL) and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Determination of Resistance Source CI12633 to Wheat Yellow Mosaic Disease

[0018] 1. DNA extraction of wheat variety CI12633

[0019] The leaves of the plants of the wheat variety CI12633 were separated and extracted by using the CTAB extraction method to extract the DNA.

[0020] 2. The DNA of the wheat variety CI12633 was detected, and the molecular markers closely linked to the main QTL for resistance to wheat yellow mosaic disease were screened out:

[0021] PCR primer Wmc327:

[0022] Upstream primer: 5'TGCGGTACAGGCAAGGCT 3';

[0023] Downstream primer: 5'TAGAACGCCCTCGTCGGA 3'.

[0024] PCR primer Gwm154:

[0025] Upstream primer: 5'TCACACAGAGAGAGAGGGAGGG 3';

[0026] Downstream primer: 4: 5' ATGTGTACATGTTGCCTGCA 3'.

[0027] PCR amplification:

[0028] The DNA of the obtained wheat variety CI12633 plant was amplified by PCR primer Wmc327, and the amplified product was separated by electrophoresis on a 12% polyacrylamide gel, and a molecular marker Xwmc327-...

Embodiment 2

[0033]Using the molecular markers Xwmc327-180 and Xgwm154-105 with sizes of 180bp and 105bp respectively to predict the resistance of wheat yellow mosaic disease to the derived lines of wheat variety CI12633:

[0034] Identification object:

[0035] The wheat variety CI12633 was crossed with Yangmai 158, and the offspring of the F8 generation were propagated. The different line numbers were defined as: E294, E304, E310, E313, E316, E322, E332, E351, E367, E386. All of them were used as identification objects whose resistance to wheat yellow mosaic disease was unknown.

[0036] Wheat cultivars CI12633 and Yangmai 158 known to be resistant to wheat yellow mosaic were used as reference identification objects.

[0037] Identification process

[0038] a) Identification by molecular markers closely linked to major QTL for resistance to wheat yellow mosaic disease

[0039] First use the CTAB extraction method to isolate and extract the DNA obtained from the leaves of each identifi...

Embodiment 3

[0052] Using the molecular markers Xwmc327-180 and Xgwm154-105 with sizes of 180bp and 105bp respectively to predict the resistance of wheat yellow mosaic disease to the derived lines of wheat variety CI12633:

[0053] Identification object:

[0054] The wheat variety CI12633 was crossed with Yangmai 158 and propagated to F 8 The descendants of different strains are defined as: E303, E305, E327, E343, E362, E397, E330, E355, E376, E379. All of them were used as identification objects whose resistance to wheat yellow mosaic disease was unknown.

[0055] Wheat cultivars CI12633 and Yangmai 158 known to be resistant to wheat yellow mosaic were used as reference identification objects.

[0056] The identification process is completely consistent with Example 2 and will not be repeated. Their results are also summarized and recorded in Table 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a molecular marker tightly linked with a wheat yellow mosaic resistant major quantitative trait locus (QTL). The molecular marker is characterized in that: polymerase chain reaction (PCR) amplification is performed on deoxyribonucleic acid (DNA) of a wheat variety CI12633 by using PCR primers, namely, Wmc327 and Gwm154; an amplification product is subjected to electrophoretic separation on 12 percent polyacrylamide gel so as to obtain molecular markers, namely, Xwmc327-180 and Xgwm154-105 tightly linked with the wheat yellow mosaic resistant major QTL; the sizes of the Xwmc327-180 and the Xgwm154-105 are 180bp and 105bp respectively; and the molecular markers are used for detecting the genotype of a derivative variety or strain of the wheat variety CI12633 so as to judge whether the derivative variety or strain can resist wheat yellow mosaic or not.

Description

technical field [0001] The invention relates to a molecular marker closely linked with a major QTL for resistance to wheat yellow mosaic disease and an application thereof, belonging to the fields of wheat breeding and molecular biology. Background technique [0002] Wheat yellow mosaic is a soil-borne viral disease caused by wheat yellow mosaic virus (WYMV). Japan's Sawada (1927) first discovered and described wheat yellow mosaic disease. Inouye (1969) proved that the pathogen of the disease was wheat yellow mosaic virus (WYMV). Because of the similar symptoms of wheat spindle streak mosaic virus (WSSMV) and wheat spindle streak mosaic virus (WSSMV), which was first discovered on winter wheat in Ontario, Canada (Slykui, 1960), both names were used in my country. and European isolates, later confirmed by genomic studies of isolates from different regions that North American and European isolates were WSSMV, while Asian isolates were WYMV (Lei, 1998; Chen, 2000). Therefore, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor 任丽娟周淼平杨学明姚金保马鸿翔
Owner JIANGSU ACAD OF AGRI SCI