Molecular marker tightly linked with wheat yellow mosaic resistant major quantitative trait locus (QTL) and application thereof
A molecular marker and wheat technology, which is applied in the fields of wheat breeding and molecular biology, can solve the problems that there are no reports on molecular markers of the main QTL for resistance to wheat yellow mosaic disease, and achieve the goal of improving breeding efficiency, high accuracy, and reducing workload Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0017] Determination of Resistance Source CI12633 to Wheat Yellow Mosaic Disease
[0018] 1. DNA extraction of wheat variety CI12633
[0019] The leaves of the plants of the wheat variety CI12633 were separated and extracted by using the CTAB extraction method to extract the DNA.
[0020] 2. The DNA of the wheat variety CI12633 was detected, and the molecular markers closely linked to the main QTL for resistance to wheat yellow mosaic disease were screened out:
[0021] PCR primer Wmc327:
[0022] Upstream primer: 5'TGCGGTACAGGCAAGGCT 3';
[0023] Downstream primer: 5'TAGAACGCCCTCGTCGGA 3'.
[0024] PCR primer Gwm154:
[0025] Upstream primer: 5'TCACACAGAGAGAGAGGGAGGG 3';
[0026] Downstream primer: 4: 5' ATGTGTACATGTTGCCTGCA 3'.
[0027] PCR amplification:
[0028] The DNA of the obtained wheat variety CI12633 plant was amplified by PCR primer Wmc327, and the amplified product was separated by electrophoresis on a 12% polyacrylamide gel, and a molecular marker Xwmc327-...
Embodiment 2
[0033]Using the molecular markers Xwmc327-180 and Xgwm154-105 with sizes of 180bp and 105bp respectively to predict the resistance of wheat yellow mosaic disease to the derived lines of wheat variety CI12633:
[0034] Identification object:
[0035] The wheat variety CI12633 was crossed with Yangmai 158, and the offspring of the F8 generation were propagated. The different line numbers were defined as: E294, E304, E310, E313, E316, E322, E332, E351, E367, E386. All of them were used as identification objects whose resistance to wheat yellow mosaic disease was unknown.
[0036] Wheat cultivars CI12633 and Yangmai 158 known to be resistant to wheat yellow mosaic were used as reference identification objects.
[0037] Identification process
[0038] a) Identification by molecular markers closely linked to major QTL for resistance to wheat yellow mosaic disease
[0039] First use the CTAB extraction method to isolate and extract the DNA obtained from the leaves of each identifi...
Embodiment 3
[0052] Using the molecular markers Xwmc327-180 and Xgwm154-105 with sizes of 180bp and 105bp respectively to predict the resistance of wheat yellow mosaic disease to the derived lines of wheat variety CI12633:
[0053] Identification object:
[0054] The wheat variety CI12633 was crossed with Yangmai 158 and propagated to F 8 The descendants of different strains are defined as: E303, E305, E327, E343, E362, E397, E330, E355, E376, E379. All of them were used as identification objects whose resistance to wheat yellow mosaic disease was unknown.
[0055] Wheat cultivars CI12633 and Yangmai 158 known to be resistant to wheat yellow mosaic were used as reference identification objects.
[0056] The identification process is completely consistent with Example 2 and will not be repeated. Their results are also summarized and recorded in Table 2.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 