Unlock instant, AI-driven research and patent intelligence for your innovation.

Spot crossbreeding method for detecting avian leukosis virus-J subgroup (ALV-J)

An avian leukemia virus and subgroup technology, applied in the field of dot hybridization, can solve problems such as increasing the difficulty of diagnosis, and achieve the effects of reducing direct and indirect economic losses, improving accuracy, and reducing detection costs

Inactive Publication Date: 2013-08-14
SHANDONG AGRICULTURAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] 2. The mixed infection of poultry tumor diseases increases the difficulty of diagnosis
[0018] So far, the avian blood diseases reported in our country are subgroups A, B and J, and subgroups C and D only appear in foreign countries, and have not been reported in our country

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Spot crossbreeding method for detecting avian leukosis virus-J subgroup (ALV-J)
  • Spot crossbreeding method for detecting avian leukosis virus-J subgroup (ALV-J)

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0031] The dot hybridization method for detecting ALV-J will be further described in detail below in conjunction with the accompanying drawings.

[0032] 1. Determine the conserved gene sequence of env (envelope protein gene) of each representative strain of ALV-J by comparing the homology with DNAstar analysis software:

[0033] caagccatgaaggaacatacagagaagatacgggtggaagatgatcccataggggattggtttacgcgcacgtttggtgatctaggaaggtggctcgcgaaaggtgttaagacgctactgtttgccttgcttgtcatagcctgtctattagctatcattccatgtgtaatcaagtgctttcaggattgtctatcgagaacaatgaatcagtttatggatgaacgcataagatatcatagaattaggga

[0034] 2. Use the random primer method to carry out the steps of digoxin-labeled probe as follows:

[0035] Add 1 μg of DNA template and high-pressure sterilized double-distilled water to the centrifuge tube to a final volume of 16 μl; denature the DNA in a boiling water bath for 10 minutes, and quickly put it in ice water to cool for 2 minutes; add 4 μl of digoxin primers to the centrifuge tube and brief...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting an avian leukosis virus-J subgroup (ALV-J). A nucleic acid probe is a specific gene sequence based on the cyst membranes env of the ALV-J and is 248bp in length and positioned between the 6736 bp and 6983<rd> bp of an hprs-103 prototype strain. The method comprises the following steps of: synthesizing a target gene and massively cloning the target gene; marking and preparing the nucleic acid probe of the ALV-J; extracting DNA of a cell inoculated with the viruses, performing detection by using a spot crossbreeding method, fixing the DNA by using a nylon membrane, pre-crossbreeding and crossbreeding, washing the membrane, developing and detecting that a spot crossbreeding reaction is positive. Through experiments, the optimal reaction temperature of the reaction of the ALV-J nucleic acid probe and the DNA is 50 DEG C, and the probe reaction concentration is 25ng / ml, so that the spot crossbreeding method for detecting the ALV-J is established. The result of the spot crossbreeding proves that the nucleic acid probe can effectively detect the ALV-J and effectively identify and diagnose all subgroups of avian leukosis, marek's diseases and reticuloendotheliosis, and the detection of the nucleic acid probe is quick and accurate. Thus, the invention provides a novel idea and a novel method for decolonizing the ALV-J.

Description

(1) Technical field [0001] The invention relates to a dot hybridization method for detecting J subgroup avian leukosis virus. (2) Background technology [0002] Subgroup J avian leukemia is a neoplastic disease caused by subgroup J avian leukemia virus (ALV-J). Clinical infection is mainly manifested by myeloid cell tumors, immune tolerance, high mortality and growth retardation. At present, neoplastic diseases mainly caused by subgroup J avian leukemia are spreading in chickens, especially the outbreak of angiomatous J subgroup avian leukemia has brought huge economic losses to my country's poultry industry. [0003] 1. The incidence characteristics of J subgroup avian leukemia in chicken flocks in my country [0004] (1) Early infection is common and the age of onset is significantly earlier. Subgroup J leukemia is now a common disease in young chicken flocks or pre-laying flocks. [0005] (2) The infection rate and morbidity rate remain high. In the past 10 years, th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68
Inventor 成子强刘功振张利王晓伟
Owner SHANDONG AGRICULTURAL UNIVERSITY