Spot crossbreeding method for detecting avian leukosis virus-J subgroup (ALV-J)
An avian leukemia virus and subgroup technology, applied in the field of dot hybridization, can solve problems such as increasing the difficulty of diagnosis, and achieve the effects of reducing direct and indirect economic losses, improving accuracy, and reducing detection costs
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0031] The dot hybridization method for detecting ALV-J will be further described in detail below in conjunction with the accompanying drawings.
[0032] 1. Determine the conserved gene sequence of env (envelope protein gene) of each representative strain of ALV-J by comparing the homology with DNAstar analysis software:
[0033] caagccatgaaggaacatacagagaagatacgggtggaagatgatcccataggggattggtttacgcgcacgtttggtgatctaggaaggtggctcgcgaaaggtgttaagacgctactgtttgccttgcttgtcatagcctgtctattagctatcattccatgtgtaatcaagtgctttcaggattgtctatcgagaacaatgaatcagtttatggatgaacgcataagatatcatagaattaggga
[0034] 2. Use the random primer method to carry out the steps of digoxin-labeled probe as follows:
[0035] Add 1 μg of DNA template and high-pressure sterilized double-distilled water to the centrifuge tube to a final volume of 16 μl; denature the DNA in a boiling water bath for 10 minutes, and quickly put it in ice water to cool for 2 minutes; add 4 μl of digoxin primers to the centrifuge tube and brief...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 