Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

ShRNA (Short Hairpin Ribonucleic Acid) kit for treating animal model suffered from alzheimer disease

A technology of Alzheimer's disease and animal models, applied in the direction of gene therapy, microbial measurement/testing, preparations for in vivo experiments, etc., can solve the problem of no suitable shRNA gene reagents for the treatment of Alzheimer's disease, etc. Achieve convenient inhibition, inhibit gene expression, reduce apoptosis and necrosis

Inactive Publication Date: 2011-10-19
SHANXI MEDICAL UNIV
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] The purpose of the present invention is to solve the problem that there is no suitable shRNA gene reagent for the treatment of Alzheimer's disease in the prior art, and to provide a shRNA kit for treating Alzheimer's disease animal models

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • ShRNA (Short Hairpin Ribonucleic Acid) kit for treating animal model suffered from alzheimer disease
  • ShRNA (Short Hairpin Ribonucleic Acid) kit for treating animal model suffered from alzheimer disease
  • ShRNA (Short Hairpin Ribonucleic Acid) kit for treating animal model suffered from alzheimer disease

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Design and synthesis of specific shRNA sequences.

[0030] According to the caspase-3 gene sequence (NM_009810), the caspase-3 gene-specific siRNA sequence was designed using Ambion's RNA interference design software as follows:

[0031] Sense strand: 5'-GAGTCTGACTGGAAAGCCGAA-3'

[0032] Antisense strand: 5'-TTCGGCTTTCCAGGAAGACTC-3'.

[0033] And through BLAST homology analysis, the possibility of non-specific inhibition of other gene sequences was ruled out.

[0034] The sequences of caspase-3 siRNA and its negative control are:

[0035] Gene

species

5' to 3' sequence

GC%

caspase-3 siRNA

the mouse

GAGTCTGACTGGAAAGCCGAA

52.63%

Negative control siRNA

the mouse

GAACGTGACACGTTCGGAGAA

55.32%

[0036] Based on the pGCsiL-GFP vector ( figure 1 ) Multiple cloning sites, designed at both ends of the shRNA fragment Age I and Eco R I enzyme cutting site, determine the caspase-3 gene-specific shR...

Embodiment 2

[0043] Example 2: Construction of RNA interference lentiviral plasmid vector.

[0044] 1. Construction of shRNA plasmid vector

[0045] through Hpa I and xho I double enzyme digestion recovery pFU-GW-RNAi vector ( figure 2 ) to make it linear, the enzyme digestion reaction system is:

[0046] Purified DNA plasmid (1 μg / μL)

2μL

10×buffer

5μL

100×BSA

0.5μL

Hpa I (10 U / μL)

1μL

xho I (10 U / μL)

1μL

h 2 o

40.5μL

total

50μL

[0047] Place the above mixed reactant at 37°C for 1 h, see the results of the enzyme digestion reaction image 3 .

[0048] 2. Competent state preparation:

[0049] Prepare fresh E. coli DH5α competent cells with calcium chloride:

[0050] 1) Pick a DH5α single colony from a fresh plate cultured at 37°C for 16h, transfer it to a 1L flask containing 100mL of LB or SOB medium, and culture it at 37°C for 3h with vigorous shaking (rotary shaker, 300 rpm min); ...

Embodiment 3

[0086] Example 3: Lentiviral packaging.

[0087] The lentiviral packaging system consists of three plasmid vectors pGC-LV ( Figure 5 ), pHelper 1.0 ( Figure 6 ), pHelper 2.0 ( Figure 7 ) composition, high-purity endotoxin-free extraction of the three plasmid vectors, and co-transfection of 293T cells according to the instructions of Invitrogen Lipofectamine 2000. After 8 hours of transfection, the complete medium was replaced. After 48 hours of culture, the collection of slow The cell supernatant of the virus particles was concentrated to obtain a high-titer lentivirus concentrate, and the virus titer was measured and calibrated in 293T cells. Lentiviral particles within a certain titer range can meet the needs of most in vivo and in vitro experiments.

[0088] Lentiviral packaging cells 293T are anchorage-dependent epithelioid cells, and the growth medium is DMEM (containing 10% FBS), 37°C, 5% CO 2 Cultivated in an incubator, the adherent cells grow and proliferate to ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a shRNA (Short Hairpin Ribonucleic Acid) kit for treating an animal model suffered from an alzheimer disease. The kit internally comprises shRAN slow virus expression plasmid vector concentrated liquor capable of specifically suppressing a caspase-3 gene, and shRAN slow virus expression plasmid vector concentrated liquor as negative control, wherein the shRAN comprises sequences of SEQ ID No.1 and SEQ ID NO.2 in a sequence table. Compared with other means, the shRAN sequence or a reagent obtained therefrom can specifically and conveniently suppress the expression of disease-related proteins at high efficiency when entering the body of the animal model in a certain manner and lead disease-related genes to be silent, thereby achieving the treatment purpose; and therefore, the kit provided by the invention can be used for gene therapy for the animal model suffered from the alzheimer diseases.

Description

technical field [0001] The present invention relates to a kind of shRNA gene reagent, especially a kind of shRNA that inhibits the expression of caspase-3 gene. Treatment of animal models of Alzheimer's disease. Background technique [0002] The phenomenon of RNA interference (RNA interference, RNAi) is an evolutionarily conserved defense mechanism against the invasion of transgenes or foreign viruses, and it is a sequence-specific post-transcriptional gene silencing (PTGS). It has been found in many different species of organisms, and it is transmitted between the cells of organisms, and has the function of resisting virus invasion and maintaining genome stability. RNAi technology can not only greatly promote the development of the human post-genome project, but also screen drug target genes with high throughput, promote gene therapy, new drug development, etc., and open up new ways for the treatment of cancer, genetic diseases and other diseases. The research and applica...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61K49/00C12Q1/68A61P25/28
Inventor 张勤丽牛侨李娜教霞李美琴
Owner SHANXI MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com