A construction method and application of high-yielding γ-aminobutyric acid recombinant E. coli/pet-28a-lpgad

A pet-28a-lpgad and pmd18-t-lpgad technology, applied in the biological field of fermentation engineering, can solve the problems of GABA production efficiency, pollution, long production cycle, etc., and achieve strong technology portability, easy promotion and application, The effect of short conversion cycle

Active Publication Date: 2014-10-15
JIANGNAN UNIV
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, chemical synthesis and microbial methods are mainly used at home and abroad to prepare GABA. The chemical synthesis method has severe reaction conditions and serious pollution; the microbial fermentation method has mild conditions, safety, and low cost, but the post-treatment process is complicated and the production cycle is long; Whole cell transformation The synthetic method of GABA can improve the conversion rate of the substrate and the purity of the product, and has the advantages of saving the post-treatment process, shortening the production cycle and reducing environmental pollution, and has received more and more attention from researchers at home and abroad.
[0003] The patent of the research group of the present invention "Breeding of a lactic acid bacterium for efficient transformation of L-glutamic acid into γ-aminobutyric acid" publication number: 101928679A Publication date: 2010.12.29, the patent discloses the use of Lactobacillus plantarum (LP-GB 01 -21) is a production strain with a 5L fermenter level. The whole cell transformation is carried out in the pH5.0 acetic acid-sodium acetate buffer solution. The final GABA concentration reaches 132g / L, the molar conversion rate is 94.3%, and the yield is significantly higher than other similar strains , but because Lactobacillus plantarum is a facultative anaerobic microorganism, the culture conditions are difficult to control, and the production efficiency of GABA is significantly affected by the culture conditions; at the same time, the expression level of GAD in Lactobacillus plantarum is controlled by the metabolic state of the bacteria, and the expression level Limited, whole cell transformation efficiency still needs to be improved

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A construction method and application of high-yielding γ-aminobutyric acid recombinant E. coli/pet-28a-lpgad
  • A construction method and application of high-yielding γ-aminobutyric acid recombinant E. coli/pet-28a-lpgad
  • A construction method and application of high-yielding γ-aminobutyric acid recombinant E. coli/pet-28a-lpgad

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1: Construction of recombinant Escherichia coli BL21 / pET-28a-lpgad

[0026] According to the lpgad gene sequence in the whole genome nucleic acid sequence 3254376bp of Lactobacillus plantarum subsp.plantarum ST-III (GI: 308044682) in NCBI, the primers of the glutamic acid decarboxylase coding gene were designed:

[0027] P1: GAC (GGATCC) ATGGACCAGAAGCTGTTAAC (BamH I)

[0028] P2: GGC(GCGGCCGC)TCAGGTGTGTTTAAAAGCTGTT(Not I)

[0029]The total Lactobacillus plantarum chromosome was extracted as a template, and the target gene fragment was obtained by PCR amplification. The PCR amplification conditions were 94°C, 5min pre-denaturation; 94°C for 50s, 57°C for 1min 30s, 72°C for 2min, 35 cycles; 72°C for 10min. The resulting fragment was recovered by gel and ligated with the cloning vector pMD18-T, transformed into E.coli JM109, and screened on an ampicillin resistance plate to pick out positive transformants. The extracted plasmid was digested and identified, and...

Embodiment 2

[0030] Embodiment 2: Expression and Ni-NTA purification of recombinant glutamic acid decarboxylase

[0031] Inoculate the recombinants stored in cryopreserved tubes into LB medium containing kanamycin (final concentration: 50 μg / mL), culture overnight at 37°C with shaking, transfer at 1% inoculum size the next day, and culture at 37°C until OD approx. 0.6-0.8, add human IPTG to a final concentration of 0.5mmol / L, and induce expression overnight at 16°C. The cells induced by IPTG were ultrasonically disrupted, and the supernatant was analyzed by SDS-PAGE, and a specific band with a molecular weight of about 53kDa was detected, as shown in image 3 shown. The specific enzyme activity measured in the supernatant was 8.53U / mg.

[0032] Centrifuge the overnight induced expression bacterial solution at 10000r / min, 4°C for 15min, collect the bacterial cells, suspend the bacterial cells with pH 7.4 PBS buffer solution, ultrasonically break the cells, and then filter through a 0.45 μ...

Embodiment 3

[0033] Example 3: Preliminary Study on the Enzymatic Properties of Recombinant Glutamic Acid Decarboxylase

[0034] 1) Optimum pH and pH stability: Prepare acetic acid-sodium acetate reaction buffer with pH 3.6-6.0, mix the enzyme solution with different pH reaction solutions at 30°C, and measure the enzyme activity of GAD in different pH reaction systems To investigate the effect of pH on enzymatic reactions. Then add a certain amount of enzyme solution to the above reaction buffers with different pH, and keep them warm at 30°C for 2 hours, measure the remaining enzyme activity, and investigate the stability of GAD under different pH conditions.

[0035] 2) Optimum temperature and thermal stability: Use pH4.8 reaction buffer solution at 20°C, 25°C, 30°C, 35°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C , 65 ℃, 70 ℃ to measure the enzyme activity, study the impact of temperature on the enzyme reaction. The enzyme solution was incubated at the above different temperatures for 2h, 4h,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a construction method and an application of high-yield gamma-aminobutyric acid recombinant escherichia coli / pET-28a-1pgad, in particular to a genetic engineering bacterium construction method, recombinant enzyme enzymology property study and an application to the conversion of L-glutamic acid for producing gamma amino butyric acid (GABA), which belongs to the technical field of biology in the fermentation engineering. Firstly, lactobacillus plantarum GB 01-21 glutamic acid decarboxylase (GAD) genes are obtained through polymerase chain reaction (PCR) amplification, recombinant plasmids pET-28a-1pgad are constructed, in addition, the successful expression is realized in E.coli BL21(ED3), secondly, Ni column affiliation chromatography purification is adopted on crude enzyme liquid for obtaining recombinant GAD, in addition, the enzymology property of the recombinant GAD is primarily studied for guiding the optimization of conversion conditions, finally, conversion experiments are carried out on a 5L fermentation tank, the GABA accumulation concentration can reach 204.5g / L, the mol conversion rate is 97.92 percent, and good foundation is made on the further industrial application.

Description

technical field [0001] A construction method and application of high-yield gamma-aminobutyric acid recombinant Escherichia coli / pET-28a-lpgad belong to the field of biotechnology in fermentation engineering. It specifically relates to a method for constructing genetically engineered bacteria, research on enzymatic properties of recombinant enzymes and its application in transforming L-glutamic acid to produce γ-aminobutyric acid. Background technique [0002] γ-aminobutyric acid (GABA for short) is an effective inhibitory neurotransmitter in the central nervous system, which has many important physiological functions, such as lowering blood pressure, maintaining nerve stability, enhancing memory, regulating hormone secretion, promoting reproduction, Protect liver and kidney etc. In recent years, the research and application of GABA has received extensive attention. At present, chemical synthesis and microbial methods are mainly used at home and abroad to prepare GABA. The ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12N15/60C12N15/63C12P13/00C12R1/19
Inventor饶志明田灵芝
OwnerJIANGNAN UNIV