Fluorescence quantitative PCR reaction solution and fluorescence quantitative PCR method
A technology of fluorescence quantification and reaction solution, which is applied in biochemical equipment and methods, microbial measurement/testing, DNA preparation, etc., and can solve problems such as low amplification efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0040] Template preparation: Genomic DNA was extracted from the blood of a male yellow race, and a library was constructed according to "Preparing 2-5kb Samples for Mate Pair Library Sequencing Part#1005363Rev.B" (Part#1005363Rev.B), which contained different fragment sizes The concentration of the DNA was determined by Agilent 2100 Bioanalyzer, the concentration was 18.7nM, the average size of the deoxyribonucleic acid fragment was 557bp, and the size range of the deoxyribonucleic acid fragment was 391bp-637bp. The DNA library thus constructed was used as a standard, and the 1nM standard was diluted with deionized water to 5 concentrations: 0.1pM, 1pM, 10pM, 100pM and 1000pM, which were used as reaction templates. where 1nM=10 -9 mol / L, 1pM=10 -12 mol / L.
[0041] Hydrolysis probe sequence: 5'CCCTACACGACGCTCTTCCGATCT 3' (SEQ ID NO: 1), with a fluorescent group 5-FAM (5-carboxyfluorescein) at its 5' end, and a quencher group 6-TAMRA at its 3' end (6-carboxytetramethylrhodami...
Embodiment 1
[0046] Fluorescent quantitative PCR comparison of embodiment 1 reaction system optimization and commercialized reaction system
[0047] 1. The optimized reaction system is:
[0048] 1) Optimized reaction system 1:
[0049] 10×PCR Buffer 2.5μL
[0050] 2.5mM dNTPs 2μL
[0051] 100mM MgSO 4 0.25 μL
[0052] 10mg / mL BSA 0.25μL
[0053] 10% Tween-20 0.25 μL
[0054] 100% DMSO 1.25 μL
[0055] 5M Betaine (betaine) 5μL
[0056] 10 μM Primer 1.1 0.75 μL
[0057] 10 μM Primer 2.1 0.75 μL
[0058] 10μM hydrolysis probe 0.625μL
[0059] 50×ROX reference dye 0.5μL
[0060] DNA polymerase 0.25 μL
[0061] Template 1 μL
[0062] Deionized water 9.625μL
[0063] Total 25μL
[0064] Five standard concentrations were involved in the reaction, and each standard concentration was repeated twice.
[0065] 2) Optimized reaction system 2:
[0066] 10×PCR Buffer 2.5μL
[0067] 2.5mM dNTPs 2μL
[0068] 100mM MgSO 4 0.25 μL ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com