Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for fast identifying ginseng and American ginseng

An identification method and technology of American ginseng, which is applied in the directions of biochemical equipment and methods, determination/inspection of microorganisms, DNA/RNA fragments, etc., to achieve the effect of wide applicability and accurate identification

Inactive Publication Date: 2012-06-20
INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The traits of the two are very similar, the color is basically the same, it is difficult to distinguish them by traditional methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for fast identifying ginseng and American ginseng
  • Method for fast identifying ginseng and American ginseng
  • Method for fast identifying ginseng and American ginseng

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] 1) 39 samples of ginseng and 17 samples of American ginseng collected from different origins, 20 mg of medicinal materials were taken respectively, ground on a MM400 ball mill (Retsch, Germany), and extracted with a plant genome DNA kit from Tiangen Biochemical Technology (Beijing) Co., Ltd. total DNA.

[0023] Table 1 Ginseng and American ginseng samples

[0024]

[0025]

[0026] 2) PCR amplification

[0027] The primer sequence is ITS2-F: AACCATCGAGTCTTTGAACGC; ITS2-R: CCTTGTAAGTTTCTTTTTCCTCC, synthesized by Sangon Bioengineering Co., Ltd. (Beijing). Primers were dissolved in sterile deionized and diluted to 2 μmol / μL.

[0028] 25μL reaction system: PCR Buffer (10×) 2.5μL, Mg 2+ 2 μL (25 mmol / L), 2 μL (2.5 mmol / L) of dNTPs mixture, 1.0 μL (2.5 μmol / L) of each primer, 1 μL (~30ng) of template DNA, 1.0 U of Taq DNA polymerase, add sterilized double distilled water to 25 μL for PCR amplification.

[0029] PCR reaction program: Perform the amplification reacti...

Embodiment 2

[0039] Basically the same as Example 1, the difference is that the ginseng root and American ginseng root in Example 1 are prepared into decoction pieces, and the decoction pieces are used as samples to extract DNA and carry out identification. As a result, the above two SNPs can also be specifically detected location.

Embodiment 3

[0041] Basically the same as in Example 1, the difference is that the ginseng root and American ginseng root in Example 1 are prepared into powder, and the powder is used as a sample to extract DNA for identification. As a result, the above two SNPs can also be specifically detected location.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for fast identifying a ginseng and an American ginseng; the method comprises the following steps of: (1) using the DNA (Deoxyribonucleic Acid) of a sample to be tested as a template, and amplifying a fragment containing a sequence as a SEQ ID No. I shows; and (2) sequencing an amplified product, analyzing the sequence as the SEQ ID No. I shows, beginning from the 5' end of the sequence as the SEQ ID No. I shows, identifying the sample as the ginseng if the 32nd place is C and / or the 43rd place is T, and identifying the sample as the American ginseng if the 32nd place is T and / or the 43rd place is C. The method can be used for fast and accurately identifying original plants, medicinal materials, raw decoction pieces and powder of the ginseng and the American ginseng.

Description

technical field [0001] The invention refers to the technical field of identifying varieties of Chinese medicinal materials, and specifically relates to a method for identifying ginseng and American ginseng with specific SNPs. Background technique [0002] Ginseng (Panax ginseng) and Panax quinquefolius (Panax quinquefolius) are Araliaceae Panax plants and dried roots respectively, both of which are rare and precious Chinese medicinal materials. Because of their remarkable effects in tonifying deficiency and curing diseases, they are widely used in clinical practice. The properties of the two are very similar, and the colors are basically the same, so it is difficult to distinguish them by traditional methods. However, there is a big difference between the two in terms of medicine and efficacy. Ginseng has the effects of invigorating qi, solidifying, promoting body fluid, improving intelligence and calming the nerves. American ginseng has the effects of invigorating qi and n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 韩建萍陈晓辰姚辉宋经元陈士林
Owner INST OF MEDICINAL PLANT DEV CHINESE ACADEMY OF MEDICAL SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com