Method for fast identifying ginseng and American ginseng
An identification method and technology of American ginseng, which is applied in the directions of biochemical equipment and methods, determination/inspection of microorganisms, DNA/RNA fragments, etc., to achieve the effect of wide applicability and accurate identification
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Example Embodiment
[0021] Example 1
[0022] 1) 39 samples of ginseng and 17 samples of American ginseng collected from different origins, 20 mg of medicinal materials were taken respectively, ground on a MM400 ball mill (Retsch, Germany), and extracted with a plant genome DNA kit from Tiangen Biochemical Technology (Beijing) Co., Ltd. total DNA.
[0023] Table 1 Ginseng and American ginseng samples
[0024]
[0025]
[0026] 2) PCR amplification
[0027] The primer sequence is ITS2-F: AACCATCGAGTCTTTGAACGC; ITS2-R: CCTTGTAAGTTTCTTTTTCCTCC, synthesized by Sangon Bioengineering Co., Ltd. (Beijing). Primers were dissolved in sterile deionized and diluted to 2 μmol / μL.
[0028] 25μL reaction system: PCR Buffer (10×) 2.5μL, Mg 2+ 2 μL (25 mmol / L), 2 μL (2.5 mmol / L) of dNTPs mixture, 1.0 μL (2.5 μmol / L) of each primer, 1 μL (~30ng) of template DNA, 1.0 U of Taq DNA polymerase, add sterilized double distilled water to 25 μL for PCR amplification.
[0029] PCR reaction program: Perform the ...
Example Embodiment
[0038] Example 2
[0039] Basically the same as Example 1, the difference is that the ginseng root and American ginseng root in Example 1 are prepared into decoction pieces, and the decoction pieces are used as samples to extract DNA and carry out identification. As a result, the above two SNPs can also be specifically detected location.
Example Embodiment
[0040] Example 3
[0041] Basically the same as in Example 1, the difference is that the ginseng root and American ginseng root in Example 1 are prepared into powder, and the powder is used as a sample to extract DNA for identification. As a result, the above two SNPs can also be specifically detected location.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap