Noninvasive lung adenocarcinoma susceptibility gene assay kit
A detection kit and susceptibility gene technology, applied in the field of molecular biology, can solve the problems of gene deletion, loss of function, improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0021] Example 1. Use of detection kit
[0022] 1. Extract DNA template
[0023] Scrape the epithelial cells of the oral mucosa of the subject, and extract the genomic DNA by phenol-chloroform method.
[0024] 2. PCR amplification reaction
[0025] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0026] (1) CYP1A1 (Ile462Val) forward primer: 5'CTTGCCTGTCCTCTATCCTTTG3'
[0027] CYP1A1 (Ile462Val) reverse primer: 5'CAGGCTGAACCTTAGACCACA3'
[0028] (2) CYP1A1 (MspI) forward primer: 5'GGGAGGAAGAAGAGGAGGTAG3'
[0029] CYP1A1(MspI) reverse primer: 5'AGGTTCTTGAAAGCAGGGACT3'
[0030] (3) XRCC1 (Arg399Gln) forward primer: 5'TGACCTTGCGGGACCTTAG3'
[0031] XRCC1 (Arg399Gln) reverse primer: 5'CCAAGACCCTTTCACTCCTATC3'
[0032] (4) MTHFR (C677T) forward primer: 5'AGGGAGGCTTCAACTACGC3'
[0033] MTHFR (C677T) reverse primer: 5'GCGGTTGAGGGTGTAGAAGT3'
[0034] (5) GSTM1 (Null / Present) forward primer: 5'GAACTCCCTGAAAAGCTAAAGC3'
[0035] GSTM1(Null / Pre...
Embodiment 2
[0056] Example 2. Service of non-invasive genetic testing for people to prevent lung adenocarcinoma
[0057] 1. Sampling and extraction of DNA
[0058] Instructed by a hospital laboratory physician to use oral sampling swabs for oral epithelial cell sampling, and phenol-chloroform method for oral epithelial cell DNA extraction
[0059] 2. Genotyping
[0060] Using the kit provided by the present invention, the Ile462Val and MSPI site polymorphisms on the CYP1A1 gene of the subject's genomic DNA, the Arg399Gln site polymorphism on the XRCC1 gene, the C677T site polymorphism on the MTHFR gene, and the GSTM1 gene deletion DNA sequencing was performed on the 6 SNPs of the present / Null polymorphism and the GSTT1 gene deletion (Present / Null) polymorphism to determine the 6 SNPs The genotype of the locus.
[0061] 3. Risk assessment of high-risk groups of lung adenocarcinoma
[0062] Through the analysis of the SNPs genotypes of the subjects, a risk assessment analysis report sheet for lung a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 