Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Detection method of JC virus as well as kit and application thereof

A detection kit, JC virus technology, applied in the determination/inspection of microorganisms, methods based on microorganisms, microorganisms, etc., can solve the problems of no detection methods or reagents, and achieve timely case diagnosis and treatment and treatment effect monitoring, effective and accurate Quantitative detection, good specificity

Inactive Publication Date: 2013-05-01
THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, domestic research on JCV is still blank, and there are no mature detection methods or reagents

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of JC virus as well as kit and application thereof
  • Detection method of JC virus as well as kit and application thereof
  • Detection method of JC virus as well as kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0077] 1. Design of primers and probes: Design specific primers JCV-F and JCV-R for the JC virus genome, and Taqman fluorescent probe JCV-P. The fluorescent group labeled at the 5' end of Taqman fluorescent probe JCV-P is 6-carboxyfluorescein (6-carboxyfluorescein, FAM), and the quencher group labeled at the 3' end is Black Hole Quencher 1 (Black Hole Quencher 1 , BHQ1).

[0078] JCV-F: GGTATACACAGCAAAAGAAGCAACA;

[0079] JCV-R: CAGTGATGATGAAAACACAGGATCC;

[0080] JCV-P: GCATGCAGATCTACAGGAAAGTCTTTAGGGT;

[0081] (sequence direction 5'-3')

[0082] 2. Preparation of the JC virus DNA polymerase chain reaction solution: mix the components (primers, probes and reaction buffer) together in a certain proportion. The polymerase chain reaction solution for a single reaction includes: 2.5 μl of 10× reaction buffer, 0.60 μl of JCV-F (10 μM), 0.30 μl of JCV-R (10 μM), 0.70 μl of JCV-P (10 μM), 3.0 μl of dNTP, and finally Make up the reaction system to 19.8 μl with sterile ultrapure ...

Embodiment 2

[0098] The construction of embodiment 2JCV quantitative standard substance I-IV:

[0099] (1) Preparation of detection reaction system: PCR reaction solution 19.8 μl, DNA polymerase 0.2 μl, purified virus genome 5.0 μl, perform PCR reaction, the reaction conditions of PCR reaction are: 94°C, 4 minutes; 94°C, 15 seconds; 60°C, 35 seconds, 40 cycles;

[0100] The PCR reaction solution includes: 10× reaction buffer 2.5 μl, JCV-F (10 μM) 0.60 μl, JCV-R (10 μM) 0.30 μl, JCV-P (10 μM) 0.70 μl, dNTP 3.0 μl, and finally use sterile ultrapure Water was used to make up the reaction system to 19.8 μl.

[0101] (2) Insert the amplified product into the T vector to construct a recombinant plasmid, and after gene sequencing confirms that it is correct, the recombinant plasmid is transformed into bacteria and amplified.

[0102] The obtained DNA sequence was directly connected to the pSTV28 DNA vector by T4 phage DNA ligase, and the pSTV28 DNA vector was purchased from Takara Company. The...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a detection method of a virus and a kit and particularly relates to a detection method of a JC virus and a kit thereof. The detection comprises the following steps of: firstly, designing specific primers JCV-F and JCV-R and a Taqman fluorescence probe JCV-P aiming at a JC virus gene group; marking a fluorophore on a 5' end of the Taqman fluorescence probe JCV-P and marking a quencher at any position of the Taqman fluorescence probe JCV-P except the 5' end; then treating a sample to be detected and carrying out PCR (Polymerase Chain Reaction); and finally, detecting a reaction result by using a fluorescent quantitation PCR instrument. The detection method disclosed by the invention has the advantages that carrying out qualitative and quantitative detection can be realized, and high sensibility, good specificity, rapid reaction and low cost can be realized. The invention further relates to a detection kit of the JC virus and an application of the method.

Description

technical field [0001] The invention relates to a virus detection method and a kit, in particular to a JC virus detection method and a kit. Background technique [0002] JC virus (JCV) is a human polyomavirus, a small double-stranded DNA virus. JCV was first discovered and isolated from patients with progressive multifocal leukoencephalopathy (Progressive Multifocal Lukoenphalapathy, PML) by PADGETT in 1971. The virus has only one serotype, but can be divided into more than 30 genotypes. [0003] JCV is an opportunistic infectious pathogen, and the serological positive rate in the normal population is as high as 80%. Primary infection generally occurs in childhood and is mostly asymptomatic. JCV can be transmitted from mother to child through childbirth (placenta), breast-feeding or long-term co-living contact, and can also be transmitted through the respiratory and digestive tracts. After the initial infection, JCV exists in human tissues in a latent state, but when the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12R1/93
Inventor 石炳毅钱叶勇蔡明宋玉亮韩永王新颖范宇解俊杰叶锋
Owner THE 309TH HOSPITAL OF CHINESE PEOPLES LIBERATION ARMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com