PCR (Polymerase chain reaction) primer capable of simultaneously detecting five soil-borne fungal diseases of wheat paddock and detecting method thereof
A technology for soil-borne fungi and detection methods, which can be used in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0027] A PCR primer for simultaneous detection of five soil-borne fungal pathogens in wheat fields,
[0028] The sequences of the sheath blight primers are as follows:
[0029] Upstream primer P1: 5′- TCCTCCCGCTTATTGATATGC -3′;
[0030] Downstream primer P2: 5′-CGGTTGAGCTGGGTCTTTTA-3′;
[0031] The sequences of the F. graminearum primers are as follows:
[0032] Upstream primer P3: 5′-CGGGGTAGTTTCACATTTCCG-3′;
[0033] Downstream primer P4: 5′- GAGAATGTGATGACGACAATA -3′;
[0034] The sequences of the primers for the pathogen of wheat take-all are as follows:
[0035] Upstream primer P5: 5′- TATGTCAGAGCGGTGAACG -3′;
[0036] Downstream primer P6: 5′-TTCGGTGCCTGGATAGTGA -3′;
[0037] The sequence of the Helmintheroides primer is as follows:
[0038] Upstream primer P7: 5′-CGAGCAAGTTGTCAAGGAG-3′;
[0039] Downstream primer P8: 5′-GTGAAAGTCTCAATAGCACCC-3′;
[0040] The sequences of the Fusarium graminearum primers are as follows:
[0041] Upstream primer P9: 5′- ACAGATGA...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com