PCR (Polymerase chain reaction) primer capable of simultaneously detecting five soil-borne fungal diseases of wheat paddock and detecting method thereof

A technology for soil-borne fungi and detection methods, which can be used in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc. Effect

Active Publication Date: 2012-11-28
HENAN AGRICULTURAL UNIVERSITY
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Moreover, these diseases often occur in combination, causing greater losses
Early diagnosis can provide a basis for disease prevention and control, but these fungal diseases are all soil-inhabiting bacteria, causing symptoms that are difficult to distinguish at the seedling stage, and traditional early identification methods cannot quickly and accurately obtain results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR (Polymerase chain reaction) primer capable of simultaneously detecting five soil-borne fungal diseases of wheat paddock and detecting method thereof
  • PCR (Polymerase chain reaction) primer capable of simultaneously detecting five soil-borne fungal diseases of wheat paddock and detecting method thereof
  • PCR (Polymerase chain reaction) primer capable of simultaneously detecting five soil-borne fungal diseases of wheat paddock and detecting method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0027] A PCR primer for simultaneous detection of five soil-borne fungal pathogens in wheat fields,

[0028] The sequences of the sheath blight primers are as follows:

[0029] Upstream primer P1: 5′- TCCTCCCGCTTATTGATATGC -3′;

[0030] Downstream primer P2: 5′-CGGTTGAGCTGGGTCTTTTA-3′;

[0031] The sequences of the F. graminearum primers are as follows:

[0032] Upstream primer P3: 5′-CGGGGTAGTTTCACATTTCCG-3′;

[0033] Downstream primer P4: 5′- GAGAATGTGATGACGACAATA -3′;

[0034] The sequences of the primers for the pathogen of wheat take-all are as follows:

[0035] Upstream primer P5: 5′- TATGTCAGAGCGGTGAACG -3′;

[0036] Downstream primer P6: 5′-TTCGGTGCCTGGATAGTGA -3′;

[0037] The sequence of the Helmintheroides primer is as follows:

[0038] Upstream primer P7: 5′-CGAGCAAGTTGTCAAGGAG-3′;

[0039] Downstream primer P8: 5′-GTGAAAGTCTCAATAGCACCC-3′;

[0040] The sequences of the Fusarium graminearum primers are as follows:

[0041] Upstream primer P9: 5′- ACAGATGA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a PCR (polymerase chain reaction) primer capable of simultaneously detecting five soil-borne fungal diseases of wheat paddock, wherein the sequence of the rhizoctonia solani primer is as follows: an upstream primer P1: 5'-TCCTCCCGCTTATTGATATGC-3'; and a downstream primer P2: 5'-CGGTTGAGCTGGGTCTTTTA-3'. A multi-PCR detecting system built by the invention can simultaneously detect the five pathogenic funguses such as rhizoctonia cerealis, gaeumannomyces graminis, fusarium graminearum, fake fusarium graminearum and bipolaris sorokinianum. The size of an amplified product segment disclosed by the invention is accordant with an expected result, and five pairs of the primers only can be generated aiming at the target specific stripe and the non-specific stripe, so that the five pathogenic funguses can be well distinguished from one another. The PCR primer is convenient and quick: a sample can be prepared and detected within four hours, and the five pathogens such as the rhizoctonia cerealis, the gaeumannomyces graminis, the fusarium graminearum, the fake fusarium graminearum and the bipolaris sorokinianum can be simultaneously detected; the PCR primer is high in sensitivity: 0.39ng of a pathogen DNA (deoxyribonucleic acid) sample can be detected: and the PCR primer is exact: compared with the conventional separation identifying and symptom identifying method,the PCR primer is higher in the accuracy of the detecting result.

Description

technical field [0001] The invention belongs to a new technology for molecular detection of fungal pathogens in crops, and in particular relates to the establishment and application of a method for detecting five kinds of soil-borne fungal pathogens in wheat fields by multiplex PCR. technical background [0002] Soil-borne fungal diseases of wheat include sheath blight, take-all, root rot and stem-base rot, etc. These diseases can cause serious reduction in wheat yield, and are important diseases that threaten the safe production of wheat at present. Moreover, these diseases often occur in combination, causing greater losses. Early diagnosis can provide a basis for disease prevention and control. However, these fungal diseases are all soil-inhabiting bacteria, and the symptoms caused by them are difficult to distinguish at the seedling stage. Traditional early identification methods cannot quickly and accurately obtain results. The development of molecular biology and the b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11
Inventor李洪连陈清清孙炳剑张煜施艳袁虹霞邢小萍
OwnerHENAN AGRICULTURAL UNIVERSITY